Excerpts from: 
The Creation Story

Copyright 1999 Bill Kinney

                                               A Beautiful Delusion
                                            (The Abomination that Causes Desolation)

Preface:

Who was the historic person known as Jesus Christ? 
Was He a man or God (YHWH) in the flesh?  Or was He both God (YHWH) and man?  
This is a fundamental question that must be answered by every person who is in search of the truth. The correct understanding of the nature of Christ is needed to comprehend the most important aspect of His mission as the Messiah of YHWH. 
Namely, how did he reverse the curse of sin and death that we inherited from Adam? 

There is a hidden element within those questions that it is not generally known. Sometimes our personal understanding of the scriptures is derived mostly from our upbringing and formal training. Whether we care to admit it or not, Christianity became an institution complete with customs and traditions that many follow without question. We tend to trust our leaders for the answers. However, even if their teaching is of sound doctrine, the scriptures are quite plain in saying that our search for the truth must be advanced through a personal study. The truth is "the treasure" buried in a field, and the scriptures are the treasure map. Studying the map is the only way to develop a close relationship with our Creator. There are many voices out there, but only God (YHWH) can give us confirmation of the truth. The hidden element I referred to is not a new doctrine. As you will see, it is has always been there waiting for you to discover it, just as I have. 
I once asked my Father to explain to me the hidden wisdom behind the Book of Revelation. His answer was simple; first read and understand the story of Creation. What happens in the end of days, is the restoration of what was started in the beginning. We will return to the Garden of Eden. Anyone who desires to understand the fulfillment of all things, must understand what took place in the beginning.  

When Adam gave his authority over to Satan, what actually occurred was a legal transfer of power. After which, Satan constructed what can only be called a counterfeit reality. It is a counterfeit because it exists in opposition to the Creator's will. It is not a false reality; whatever happens here affects all of creation, in a real way.  Yet, it is not the reality our Creator planned for us in the beginning.  If it were, then Christ would not have prayed, "your will be done on earth as it is in heaven," obviously meaning that the Father's will is not done on earth.
Within the parameters of his counterfeit reality, the master deceiver has sent out many false teachers and prophets to confuse the people. They erect fences and walls around the minds of their victims. They propagate myths, fables, and stories; and create false interpretations of scripture that water down or eliminate the truth. They may even appear to be sincere followers of YHWH, but they have aided the enemy in this age old war. A war that is fought to control your thoughts and your mind, and ultimately your body. The weapons used in this warfare are words. Be not mistaken, there is real power behind the spoken word. We use letters to create words, and we call this exercise, "spell-ing." Even our English word "grammar," which is defined as a set of language rules; comes from the 12th Century French word, "grammoire" (from a Latin root) and  means, "Book (or rules) of Magic."  But what is a spell? Most people attach a negative connotation to the word, and rightly so. Yet the English word "gospel" is derived by combining the words "good-spell." We can use a "gospel"  to proclaim the "good news;" or we can cast a spell through lies and deceit, using words to create suspicion, doubt, fear, and unbelief.
Consider the Hebrew word "nachash," [pronounced, naw-khawsh] which is translated as "serpent," and is used to describe the one who was in the beginning, in the Garden of Eden. This word can be a noun or a proper name. As a noun it means enchanter, to whisper a spell (or spell caster), magician, and prognosticator.  
Each one of those definitions involves manipulation through the use of words. This is exactly what happened in the Garden of Eden. In Old Testament manuscripts, this very same "nachash" receives the definite article "the," which is written in Hebrew as "haNachash," making this word a personal name. It is haNachash (Satan, the serpent) who gently persuaded Adam's wife, with carefully chosen words, to consider her "other options." He even had a prognosis for Eve, saying to her, if she ate the fruit of knowing good and evil, she would "not surely die." 
I don't believe this was the first time or the only time that Eve spoke with haNachash. His plan for Eve's downfall was a work in progress. It began when he challenged Eve's perception of the truth. He did this to lay the foundation for his counterfeit reality. Satan had to convert words into actions, but not by force. The scriptures are clear to point out that Satan could not have overpowered Adam and Eve by force. He had to accomplish this takeover through manipulation and deceit.

Or else how can one enter into a strong man's house, and spoil his goods, except he first bind the strong man? and then he will spoil his house. Matt 12:29 (KJV)

The "binding" being referred to here can be literal, or it can be figurative in the sense of being "spellbound."  A condition that exists when words are used to entice and fascinate someone, in order to solicit a response. The so called "victim" (or victims) have participated voluntarily, and in a real way, left themselves open to this manipulation. This is how Satan was able to usurp Adam's authority. Adam was the strong man, and Satan spoiled his house.

For this reason we are instructed to cast down imaginations that oppose the truth before they become strongholds that must be - pulled down. They are restraints that hinder our spiritual understanding. They are invisible walls that are just as solid as concrete. 
In these last days, as the knowledge of God (YHWH) and his truth increases (in fulfillment of prophecy) the counterfeit reality will crumble. But before it completely falls, there will be one more challenge which will be the greatest test of all. Medical science, specifically biotechnology (with the assistance of nano-technology) will reconstruct the gene sequence that enables immortal life. God (YHWH) will allow this proprietary information to be used to bring about the strong delusion spoken of in 2 Thessalonians. This delusion will be made manifest so that the wicked;

".. should believe a lie:" 2 Thess 2:11(KJV)

That lie will amount to this; 

the curse of sin and death has been reversed. 

We no longer need to wait for life everlasting. Science has taken from God (YHWH) that which is continual - his self existent life. 
The Creator's Holy image, which he imprinted on our bodies and later called "His temple;" will be desolated (made barren) by the abomination (moral revulsion) known as the Son of Perdition (the anti-Christ). At the heart of this delusion will be the anti-Christ's ability to impart this immortality to others;

for a price. 

The sin cursed and mortal body of flesh, will be synthetically converted by means of a genetic therapy, into an immortal life. Man, who has been cut off from the tree of life since the Garden of Eden, will climb in over the back wall - just as Christ prophesied. 
The immortal life therapy will enable the lame to walk, the blind will see, the mute will speak, and those maimed will be made whole.   

And great multitudes came unto him, having with them those that were lame, blind, dumb, maimed, and many others, and cast them down at Jesus' feet; and he healed them:
Insomuch that the multitude wondered, when they saw the dumb to speak, the maimed to be whole, the lame to walk, and the blind to see: and they glorified the God of Israel. Matt 15:30-31 (KJV)


This therapy will duplicate the work which was done by the true Messiah.
There will be no sickness or death. It will even reverse the aging process.
The person who brings all of this to the people of earth - will be nothing less than a Messiah.
Just as it happened almost 2000 years ago, great multitudes will come unto him, the anti-Christ, and glorify the God of Israel, and shall wonder over his work. Only this "messiah" will be the Son of Perdition, and the god who sent him is the dragon of Revelation 13:4.

It will be a beautiful delusion. Unlike any other ever seen before on earth.


Author's note:

In our English Bibles, we have become accustomed to reading transliterated versions of ancient Hebrew names. Any search for knowledge and truth, must include a study of Hebrew words, especially proper names. Such a study is so far reaching in its content, that it cannot be fully addressed within the confines of this book. Sufficed to say, there is a weightier matter at stake here that is completely worthy of your attention. To ignore it would be to your own detriment. Our Creator did not use Greek, Latin, or English words to create the heavens and the earth. He used the twenty two letters of the Hebrew aleph-bayt (alphabet). For this reason alone, we should acknowledge their rightful place of authority and influence. But most importantly, there are things expressed in the Hebrew that are not conveyed in other translations, or transliterations.
Consider this unusual exchange of words taking place in John's gospel between Christ and the Pharisees. If you make a casual reading of this passage, you will miss it's entire life changing message.

Now about the midst of the feast Jesus went up into the temple, and taught.
And the Jews marvelled, saying, How knoweth this man letters, having never learned? John 7:14-15 (KJV)


At this point in time, Christ is teaching in the temple at Jerusalem when the scribes make this curious statement about "having never learned."  What makes this saying peculiar is that Christ knew how to read and write since he was a child. Every Hebrew child was taught how, and every male child was required to read from the scrolls at the synagogue on shabbat (the sabbath).
So why did the Jews marvel? Because "knowing letters" in this case referred to a deeper course of study into the names and meanings of each Hebrew letter and the words they form;  including derivative and compound words that never stray from the root word or even the meaning of the individual letters themselves. This is how the true meaning (or translation) of words is revealed and then entire sentences are interpreted. That's more than can be said of any other language. That's why this course of study was reserved for those in power; namely scribes, scholars, and priests.  Understanding Hebrew is a "key of knowledge," that opens up a greater dimension to understanding all of the scriptures.  Notice how Christ replies to their comment in the next verse:
 
Jesus answered them, and said, My doctrine is not mine, but his that sent me. John 7:16 (KJV)

Notice that "knowing letters" in this case, was directly related to a doctrine that Christ was teaching! There was something hidden in the scriptures that was being revealed by his teaching, and it was directly influenced by his knowledge of letters. If it were not so, the Pharisees would not have marvelled at his teaching. They would not have been puzzled by His understanding and wisdom.

The Pharisees were "the power elite." They did not want this knowledge to be known among the people. They were practitioners of an age old religious practice that is still in use today.
This practice is the structured division between clergy and laity; between those who "know," and those who should just "listen." The Pharisees were among the group responsible for promulgating one of the most devious plots ever perpetrated on the Hebrew nation and the world in general. They hid the name of our Creator from view, and made the vocalization of his name a crime punishable by death. All of this was in direct opposition to YHWH's decree, that his name should be made known, held in esteem, exalted and praised. None of which can occur if it is hidden and unlawful to say. 

In view of this knowledge and from this point forward, I will not use any transliterations of the Hebrew names. The Creators name, which appears in the scriptures as the four Hebrew consonants YHWH, should have been written out in full, with all of its vowels.
Do not dismiss this as a matter of semantics. Or say to yourself, what does it matter YHWH knows when someone calls upon him regardless of what name they use. 
If that were so, then why did the Creator of all things declare to Moses;

...YHWH...: this is my name for ever, and this is my memorial unto all generations. Exod 3:15 (KJV)

YHWH is His personal name. "God," and "Lord" are mere titles and not personal names.
There are many scholars who say that the original pronunciation was lost over time, or during the Babylonian captivity. Others say that the vowels points were changed or altered to hide the name and protect it from being blasphemed, so you will never know which ones are correct. All I can say is, the Creator revealed his name so it could be spoken and proclaimed among men; so that it would be a blessing here on earth, as it is in heaven. 
He commanded Moses to;

"Write these words, for according to the tenor of these words I have made a covenant with you and with Israel." Exod 34:27 (NKJ)

The English word "tenor" has fallen into disuse in everyday speech; but it's meaning has not changed over the years. With regard to an "utterance," it is a noun denoting cognitive processes and contents. It means; not only to say the words of a sentence; but to convey the idea intended, to pervade the meaning by the inflections and expressions of your voice. All of which is impossible to do without vowels. Why then, would YHWH allow the vowels of His name to be altered or removed so the pronunciation of His name could be lost or forgotten? Would He not, at the very least, leave a witness to the correct rendering of His name somewhere in the scriptures?
He certainly has.
I
t is time for all of YHWH's children to break free from this self imposed ignorance! When we accept this lie, we give the deceivers power over our lives. We become their servants. Words have power, and so does the personal name of our Creator.

Shown below is a reference chart for the Hebrew names commonly transliterated into English, that appear in this writing. If a Hebrew word has a number behind it, it means that word is referenced to Gesenius' Hebrew-Chaldee Lexicon, and Strong's Exhaustive Concordance of Hebrew Words.


The transliterated names are listed below, consonants first and vowels in parenthesis;


YHWH, which is usually translated as  "God," or "The LORD GOD;"  is spelt Yod (kawmates) hay-waw ( shurake) hay, and pronounced, Yahuah (Yaw-hoo-ah).



[Actually, there is no capitalization in Hebrew].


UL, which is translated as the word "Almighty," as in "Almighty God," is spelt aleph-waw (shurake) lamed, and is pronounced, "UL" (ool or uwl) 
It is  #193, and stands in place of the name for the Canaanite deity, "El." 
UL means "mighty one." Or in the case of "YHWH UL," Yahuah The Mighty One!



"Ul" is also a particle that appears in many Hebrew proper names. Such as DaniUl (instead of Daniel).


YHWHSWA, which is usually transliterated as "Jesus," is spelt Yod (kawmates) hay-waw (shurake) hay-shin-waw (shurake) ayin, and is pronounced, Yahuahshua (meaning, Yahuah - is our salvation).



There are other Hebrew names which are usually given to the messiah, but are not gramatically correct. Some of them are;

Yeshua (sometimes spelled yashua) This word is a noun and not a proper name. It means "something saved."  It is a feminine passive participle of the verb "yasha" which means to be open, wide, or free.

Yahshua, and Yahushua are the Hebrew equivalents of the English name, "Joshua." Since these names were quite common among the Hebrews, they could not satisfy the requirement that the Messiah's name be above all other names;

Therefore Yahuah also has highly exalted Him and given Him the name which is above every name,... Phil 2:9 (NKJ)

No one else has ever had the name, Yahuahshua. A name which incorporates all four letters of the Father's name. 

"I have manifested Your name to the men whom You have given Me out of the world. John 17:6 (NKJ)

"Manifested" in this case means, "to make apparent." Yahuahshua made known to the disciples the Father's name which had been hidden by the religious leaders of Israel.


The word "Mashiyach" or "HaMashiyach" is usually translated as "Christ," and means in the Hebrew "The Messiah."


Foreward

The theological doctrine of propitiation, or the satisfaction of Yahuah's wrath upon sin has a dual aspect. Not only did the Messiah obtain forgiveness for the acts of sin we commit while in this body, he also reversed the curse that put us in this body to begin with. There is an important distinction to be made regarding those two points. 
The Old Testament states explicitly that Yahuah can forgive sins, without a sacrifice. A person could live a righteous life by obeying the Torah. This was demonstrated in the scriptures when Moses gave the Hebrews the 10 commandments, and they responded by saying;

And it shall be our righteousness, if we observe to do all these commandments before Yahuah our Ul, as he hath commanded us. Deut 6:25 (KJV)

You may be thinking, how can this be, a righteousness by obeying the Torah? Living under the Law?
That's not what Paul said;

Therefore by the deeds of the law there shall no flesh be justified in his sight: for by the law is the knowledge of sin. Rom 3:20 (KJV)

Therein lies the great debate between what is usually presented as opposites; the Torah (Law) vs. grace; and faith vs. works. Arguments for either opinion are usually centered around the thesis that the Torah produced condemnation while grace results in justification. The Torah provided only atonement, while justification through grace brings about redemption.
Realistically, presenting these ideas (or doctrines) in this way, comes from a lack of knowledge.
Abraham was credited with righteousness in Gen 15:6. Yahuah himself testified that Abraham was his friend (Isa 41:8) because he walked in his Torah (Gen 26:5).
  To put that in perspective, Yahuah made that statement 500 or more years before the Torah (10 Commandments) was given to Moses.  So how could Abraham follow something that didn't exist yet? The simple answer is, the Torah has existed since the beginning of Creation, in the form of the original "Ten Words." What is commonly known as the "10 Commandments" should actually be translated from the Hebrew as "the 10 words (or utterances)." These ten words are, 

"Love Yahuah with all your heart, and your neighbor as yourself."  [taken from Duet 6:5 and Lev 19:18]

HaMashiyach would later say; 

"On these two commandments hang all the law and the prophets." Matt 22:40 (KJV)

The Torah was the original 10 words which YHWH "enjoined" (or bade) Adam to keep and walk in.

Anyone who has the 10 words (Torah) of Yahuah written in their hearts, does not need any other laws. They are guided by the spirit and driven to perfection by their love for Yahuah and His Torah.
During his ministry, Yahuahshua himself told several people that their sins were forgiven, and indeed, they were! Yet, even with our sins forgiven and our spiritual relationship with the Father fully restored, we still suffer separation from our maker because of the fallen nature of our bodies. This is why the dual affects of sin had to be resolved. Not just the acts of sin, which can be forgiven by way of repentance. But also the law of sin and death, which reigned in our bodies. It had to be legally cancelled. The Messiah's atonement provided the way for the redemption of not only our soul, but our bodies also. This is what is meant by, " no flesh shall be justified in His sight." 
While I can repent of my sin, I cannot redeem my own flesh. This is the main theme behind the entire volume of the scriptures. The whole book of the Bible can be summed up in two words -

a body.

Therefore, when He (Yahuahshua) came into the world, He said: "Sacrifice and offering You did not desire, but a body You have prepared for Me. Heb 10:5 (NKJ)

In order to understand the meaning behind this phrase, one must see that the scriptures clearly define the existence of three types of bodies in the terrestrial (or physical) realm. The terrestrial realm does not include the angelic beings, who are spirit beings, and possess spiritual bodies.

This is a key to understanding all scripture. This is the hidden element generally unknown, because it has not been received and taught to others. Without a full understanding of this truth, you will not only miss the true physical nature of our Messiah, but you will also miss the meaning behind the phrase, the "abomination that causes desolation," which will be revealed in the person of the anti-Christ, better known as the Son of Perdition.

The three distinct types of bodies are:

1. The Immortal Body - This is the type of body that Adam and his wife possessed in the beginning, and most importantly, it was created in such a way that - it did not have to die.
I repeat - it did not have to die. Yet, it was not an eternal body, or one that is self existent. There are important and real differences to be recognized here.

The immortal body is the type of body that Yahuahshua was born with.

2. The Eternal Body - This is an added quality that the immortal body can inherit, to attain to absolute permanent self existence, in the same sense as Yahuah our Mighty One, himself. To obtain this body, our Creator enjoined (or bidded) Adam to reach out and eat of the "Tree of Life" and live eternally. He never did, and neither did his wife.

This is the type of body that Yahuahshua obtained after his resurrection. It was an eternal body.

3. A Mortal Body - This is a lowest state of existence, the one that Adam and his wife descended to once they had introduced sin into their immortal beings.
Adam and his wife were given a free will to accept or decline Yhwh’s offer. They must have been fully cognizant of their surroundings. They understood their place, position, and responsibilities within all of creation. They were not two innocent youths frolicking around the garden naked to the world. If they were, then the consequences laid upon them for their sin were too great and unfair. Yet, all of creation fell when Adam and Eve sinned, because Adam was much more than a gardener and Eve was much more than a farmer's wife. Adam was the chief administrator over all of YHWH's creation. When Adam handed over his power to Satan (the usurper), Yahuah did not simply just appoint another ruler in Adam's place. In His wisdom, Yahuah had created certain powers, principalites, and dominions to exist in perpetual support of his creation. The true wonder of it all is, this is also the power structure that he himself abides by. So great was Adam's fall, it required that Yahuah himself partake of the flesh of man, to reverse the curse of sin and death.

Adam and his wife could not have been predisposed to sin. Neither did the want for anything. They could not have possessed any sort of "built in" inclination to sin. Or for that matter, neither could it have been predetermined for them to accept Yahuah's offer for eternal life. Nor could they have been pressured in any way by their circumstances into making a hasty or untimely decision. Otherwise they did not truly have a free will, accompanied by the time they needed to experience life; to think, understand, and reason about their circumstances before making a decision.  It is this understanding that leads me to believe;

If Adam and Eve had never sinned, and had never eaten of the tree of life to live forever; they would still be here on earth, in our day and time; living in an immortal body. 

There can be no other answer to this equation. This is the scriptural distinction that must be realized between the three different types of bodies. They did not have to become eternal, neither did they have any type of degenerative weakness that in the process of time would have lead them to age and eventually die. While we don't know how much time elapsed before they sinned, it seems like they didn't wait long before making their decision. 

However,  that is NOT the point at all. They had immortal life, and nothing but sin could take it away.

Keep in mind that after Adam did sin, Yahuah did not appoint someone else to take his place. There was no second in command that would allow for a transfer of power and things to continue unchanged just as they were before Adam sinned. This is an important truth that helps to define the very nature and person of our Creator. The redemption of His creation would take place from within the framework and order that He created before He rested on the seventh day. 
A picture (or likeness) of this can be seen in the Book of Ester. A man named Haman convinced the Persian King (Artaxerxes) to destroy all of the Hebrews living in his Kingdom. A decree went out to all of the provinces, it was a lawful statute sealed by the signet ring of the King and irreversible. All Hebrews were to be killed in one single day, in eleven months time from the issuance of the decree.
Now, King Artaxerxes loved Queen Ester more than anyone else. She risked her own life to petition the King on behalf of her people (it was unknown to him that she was also a Hebrew). She revealed the true nature behind Haman's plot. The King, mindful of the irreversible decree he had granted Haman, told Queen Ester  to write a new decree; one that seemed best to her, in favor of the Hebrews, and seal it with his signet ring. Since it was against the law of the Medes and the Persians to reverse the King's decree, Ester (with the help of her kinsman Mortecai) wrote a new decree granting all Hebrews the right to defend themselves, and annihilate anyone who might assault them on that day. 
In like manner, Yahuah has put in place certain physical and spiritual laws, that He does not re-write or set aside on occasion. When we were legally condemned to death through the mortality passed down from Adam and Eve, there was no escape or exemption available for whatever reason.
Instead, Yahuah wrote a decree saying that He would send His Messiah to reverse the law of sin and death. So that through His death and resurrection, we could defend and preserve our life, by placing our trust in His provision. (Thank you, Father Yahuah).


Yahuah planned in advance, that one day (thousands of years after Adam and Eve) He would use their genetic material  to produce an offspring which would perfectly replicate the genetic sequence for an immortal life. This offspring would be the Messiah of Yahuah.

Therefore doth my Father love me, because I lay down my life, that I might take it again.
No man taketh it from me, but I lay it down of myself. I have power to lay it down, and I have power to take it again. This commandment have I received of my Father. John 10:17-18 (KJV)

The power being referred to here, is the power of an immortal life.  This is why Mashiyach was referred to as the 2nd Adam, because He also possessed an immortal body just like the first Adam. 
This is precisely how Yahuahshua reversed the curse of mortality. 
There is a spiritual law in place that governs over the power of death,  just as sure as the law of gravity governs over solid objects. This law states;

"...the soul who sins shall die. Ezek 18:4 (NKJ)

"For the wages of sin is death;..." Rom 6:23 (KJV)

"...and sin, when it is finished, bringeth forth death." James 1:15 (KJV)

If Yahuahshua had been born with a mortal body, he would have carried the penalty for sin in his own body; and his sacrifice on the cross would have been nothing more than a premature death. This would not have reversed the curse of sin and death, anymore than the sacrifice of Isaac could have reversed it.
Neither was Christ born with an eternal body, because such a body can never die.
He was born the Son of Adam with an immortal body. Although he did not sin, and should not have been penalized under the Law of sin and death; yet with these words he subjected his own immortal body to death. 

"Father, 'into Your hands I commit My spirit.'" Having said this, He breathed His last. Luke 23:46 (NKJ)

After his resurrection, He ascended to the Garden of Eden, the Paradise of Yahuah; where He presented his sinless and immortal body to His Father who granted him eternal life. Yahuahshua became the possessor and grantor of eternal life.

"To him who overcomes I will give (the right) to eat from the tree of life, which is in the midst of the Paradise of Yahuah."' Rev 2:7 (NKJ)

All of this has an immediate bearing on our day and time. Appearing soon in these last days, is the prophesied anti-Christ or "Son of Perdition." The word Antichrist meaning (in the Greek)" in place of," or "instead of Messiah." This is a bold term to use! How could anyone realistically present themselves to be in place of the historic person known as Yahuahshua HaMashiyach? This term "in place of" carries more weight than just describing someone who has a dynamic and charismatic personality, coupled with a new philosophy or religious insight.  It describes someone who can decisively mimic the life and ministry of the true Messiah.  Not in a superficial way, like the Syrian General Antiochus Epiphanies did when he defiled Solomon's temple and sacrificed pigs on the altar in the Holy of Holies. I'm talking about someone who can defile the true Temple of Yahuah, by corrupting his image through genetic engineering. By creating a man made being that possesses immortal life - apart from the self existent One, who is Yahuah.
Antiochus may have named himself  “theos epiphanies” or "god made manifest," but everyone knew he was a mere mortal who eventually died. The true Son of Perdition must be immortal, and he must be able to offer his followers immortality. Just as Yahuahshua offers all those who believe in him - eternal life. Anything less would only be a cheap imitation. 
All of our genetic research and Bio-technology from the past 50 years has been headed in one direction; the pursuit of immortal life; the ultimate power - the power of Yahuah Ul.  
It is now within our grasp. More likely than not, it has already been achieved but there has been no public announcement.

Immortal life is also the real issue behind the "falling away" spoken of in 2 Thessalonians chapter 2. (The same falling away that precedes the second coming of the Messiah). This "falling away" or defection from the true faith, warned of by the Apostle Paul, occurs almost simultaneously with the appearing of the Son of Perdition. The relationship between the two events cannot be separated by years. The "falling away" has never been about a slowly advancing lukewarm attitude that would creep into the Church over a period of decades or even centuries. This "falling away" will occur in a decisive and single moment in time. When through the advancement of Medical Science, a genetic therapy will come available which will enable people to live an immortal life. This will be a defining moment in everyone's life. The people who confess Yahuah to be their Father, and Yahuahshua to be their Messiah; will have to make a choice between two offers.

Do I accept this miracle of Medical Science, a genetic therapy that has brought about immortal life? 

Or does my faith dictate that I should die in hope of the resurrection? 

Many will reason and rationalize with themselves about the apparent good this therapy does. The sick are healed, the lame walk, the blind see, and the deaf hear! Even the recent dead have been restored to life. The aging process itself has been reversed! TV shows and News reports will undoubtedly portray this therapy as a miracle, a gift from God.
Even teachers and preachers will say, this therapy has done so much good, it could only be from God!  

That is the essence of a strong delusion. 
The ones who are being deluded, convince themselves otherwise.


 We begin at the beginning, the Book of Genesis, or, in the Hebrew, "Bereshyth." 

A simple description of the creation, from the Microsoft Encarta Encyclopedia

"Adam and Eve"

The biblical account of the creation of human beings occurs twice: in Genesis 1:26-27 and in Genesis 2:18-24. Marked differences in vocabulary, thought, and style between these accounts have led to the scholarly consensus that these creation stories reflect two distinct sources. In the first account, the Hebrew common noun adam is used as a generic term for all human beings, regardless of gender; Eve is not mentioned at all. In the second account Adam is created from the dust of the earth, whereas Eve is created from Adam's rib and given to him by Yhwh to be his wife.

Gesenius' Hebrew Lexicon notes the same distinction between Genesis 1:26-28, the Hebrew word "adam" meaning men (mankind) in general, male and female; and Genesis 2:7 the word "Adam" (capital A) becoming the name of the first man.

There should be no confusion at all. The stories are not two different versions of the creation of man; but rather two separate accounts of the creation of two different creatures. One is mankind (human beings, male and female) made on the sixth day of creation. The other is Adam, the first man, who was created before the dry land appeared, from the "dust of the world," on the third day. Bear with me on this while I show you the distinction made between these two creatures in the scriptures. This is not a doctrine of man. This can be easily demonstrated by studying the original Hebrew. Two separate and distinct creatures were made, Adam and then Mankind. Though the idea may seem strange at first, many believe in the existence of Angels, even though they may never have seen one of these celestial beings. Why? Simple because the scriptures say they exist. What if Yahuah also created terrestrial beings, made from the earth, that he called mankind? What if all three types of creatures belonged to one family, made from the same basic genetic material, yet each one arranged differently to form three separate species. Angels as spirit beings, Mankind as physical beings, and then Adam and his wife made from both elements; the terrestrial and celestial, heaven and earth, forming the perfect balance between two worlds. This unique creature named Adam, was then commissioned (as it were) by the Creator to be his chief administrator, overseeing all of creation.  In the same way that Joseph was given Pharaoh's signet ring and ruled over all of Egypt. Joseph himself was not Pharoah, yet no man could "lift his hand or foot in all the land of Egypt" without Joseph's permission. [Gen 41:44]


Take a close look at the chronology behind the two accounts of Creation given to us in Genesis chapters 1 and 2, respectively.

Adam was formed from the dust of the ground, on the second day. 
You'll notice that on each separate day of creation, Yhwh saw something that was specifically good, with two exceptions: Those two exceptions occurred on the second and sixth day.

It is important to note the two exceptions, it stands for something or it wouldn't be there.

The first day; the light (or energy) was called "good."
The second day, "it was so" (no individual affirmation given that "it is good.").
The third day; the dry land and seas are "good."
The forth day; the sun, moon, and stars are "good."
The fifth day; sea creatures and birds are "good."
The sixth day; the beast, the cattle, and the creeping thing was "good." then; 
Yhwh creates man, and "it was so" (no individual affirmation, "it is good.").

The second day of creation was not called "good." Neither was the creation of mankind (on day 6) called "good," but rather the scriptures say only; "and it was so." Why is Yahuah's personal affirmation of goodness missing from these two events?
This two acts of creation could not be called "good," because both creatures were created with a free will; and the ability to exercise free choice. Yahuah could not call them "good" because they had not yet chosen to do good; to do what is right, to walk with Yahuah in his Torah (way) and be credited  with righteousness.

Music plays an important part in the scriptures. There are only 12 musical notes in all the world. Similarly, there are 12 tribes of Israel (YawShorUl), 12 Apostles, 12 gemstones on the breastplate of judging, and 12 gates in the New Jerusalem.
Something unusual happened during the seven days of creation, that is also reflected in the 12 musical notes represented by a standard keyboard. 
When you strike a key on a piano, it creates vibrations on a string that produce a certain frequency which is called a " note." The frequency range at which these vibrations occur are different for each note. If you look at a piano keyboard, you'll notice there are two notes missing. These two notes correspond in order, to the two days that were not called "good."

Look at one octave (12 notes) of a piano keyboard. There are seven "whole" notes represented by the seven white keys; and five "half tones" represented by the five black keys.
The whole notes are the musical notes of D,E,F,G,A,B, and C (shown below).

Corresponding with the two times when Yhwh did not say "it is good" there is a musical note (or vibration) missing. If you look at the diagram below, between the notes "E and F," and "B and C" there is no black key (or half tone). These empty spaces correspond to the second day of creation, and the creation of mankind on the sixth day,  which was not called "good." The scriptures say only "and it was so."


          
What was missing in these two instances was the free will choice of two of Yahuah's creatures. If they had chosen to do what was right in the eyes of Yahuah they would have followed Him, and in a sense, completed the keyboard by bringing harmony to Creation. 
The Hebrew word "echad' which refers to the "oneness" of Yahuah, has a derivative word known as 'Yachad," which not only means "unity," but more precisely "harmony."  
It was the harmony of agreement, from among Yahuah's creation, that needed to be completed. It is represented by the two notes missing.



Vibrations themselves are present in the mechanics of Yahuah's creation from the very beginning.
The first word of the first sentence of the Bible is 'Bereshiyth' (shown below);


                
                       Be re'shiyth bawra ulheem awleph taw heshamayin ayth haerets.


Usually translated in English as "In the beginning," the Hebrew word "re'shiyth" is actually formed from the root word "ro'sh, " which means "to shake." Motion therefore, became the first part of Creation. 
In the next sentence of Genesis Chapter 1, we are told that  "...the spirit of Yahuah moved upon the face of the waters.." The Hebrew word for "moved" is "rachaph" and can also be translated as "shake," "hovering," or "fluttering." In both instances the idea of shaking or vibrating reveals the true scientific nature behind creation, the vibration of atoms. A vibration that creates density (among other things). The same density that allows me to stand on a wood floor when 86% of its properties consist of empty space. If the atoms in each molecule were not vibrating, I'd fall through the floor. 

At the end of the sixth day, Yahuah did see everything he had made, and behold, it was "very good." This general affirmation refers to the net result of Creation, which in the end, after the redemption, will be "very good."

Before we look at the scripture verses that describe Adam's "birth" on the second day of Creation, it’s important to note the primary implication behind the chronological order of this event. Adam, being made on the second day,  was a witness to everything created by Yahuah from that point on. He not only knew, but he was intimately familiar with the working order and intricacies of the creation which Yahuah was going to put him in charge of. He was not an innocent youth frolicking around naked in the garden. If he was, then how could Yahuah have charged him with sin? And consequently subjected all of creation to a state of decay on account of his sin. The only way he could have been held completely accountable is if he was entirely cognizant of his surroundings, understood his position and rank, and knew all that was expected of him in the performance of his duty. 

Read this for what it literally says, emphasis added:

This is the history of the heavens and the earth when they were created, in the day that Yhwh made the earth and the heavens, 
before any plant of the field was in the earth and 
before any herb of the field had grown. 
Gen 2:4-5a

The plants and the herbs of the field were created are the third day [Gen1:11-13]. So what is about to follow is taking place on the second day. 

For Yhwh had not caused it to rain on the earth, and there was no man to till the ground; but a mist went up from the earth and watered the whole face of the ground. And Yhwh formed man
[Adam] of the dust of the ground [meaning the primordial dust of Proverbs 8] and breathed into his nostrils the breath of life; and man [Adam] became a living being. (NKJ) Gen 2:5b-7

This is the first time in the Creation narrative that the Hebrew proper name "Adam" appears, as opposed to the sixth day creation of mankind, who is referred to as "adam" (or mankind, a proper noun).

Take another look at these verses:



Adam, the first man, was created before the third day, because the grass and herb that yields seed was brought forth during the third day.

Then Yhwh said, "Let the earth bring forth grass, the herb that yields seed, and the fruit tree that yields fruit according to its kind, whose seed is in itself, on the earth"; and it was so. And the earth brought forth grass, the herb that yields seed according to its kind, and the tree that yields fruit, whose seed is in itself according to its kind. And Yhwh saw that it was good. So the evening and the morning were the third day. Gen 1:11-13 (NKJ)

Adam was made before the dry land appeared.

.......Yhwh formed Adam of the dust of the ground. Genesis 2

It makes perfect sense that Adam, who was created on the second day, was made of the dust of the world because the dry land which was formed on the third day, had not yet appeared. This chronological order is confirmed in Proverbs 8:

"I was set up from everlasting, from the beginning, or ever the earth was. When there were no depths, I was brought forth; when there were no fountains abounding with water. Before the mountains were settled, before the hills was I brought forth: While as yet he had not made the earth, nor the fields, nor the highest part of the dust of the world." Prov 8:23-26 (KJV)

Before there were any seas in the world, or fresh water; before the mountains, hills, or earth itself was made, He made the dust of the world. This primordial dust of the world refers to the carbon molecules needed to build DNA. Carbon molecules that were formed by the thermonuclear explosion of stars at the beginning of creation. 
 

Then Yhwh said, "Let there be a firmament in the midst of the waters, and let it divide the waters from the waters."
Thus Yhwh made the firmament, and divided the waters which were under the firmament from the waters which were above the firmament; and it was so. And Yhwh called the firmament Heaven. So the evening and the morning were the second day. Gen 1:6-8 (NKJ)

In the second day of Creation, the firmament (called heaven) not only defines something tangible in the physical realm, something which separates the waters above it, from the waters below it; but it also alludes to another firmament that exists between the dimensions of the physical and spiritual planes. A doorway between the two worlds, that separates "the waters."  The scriptures refer to two different types of water; one type in the spirit realm (flowing from the throne of Yhwh in Rev 22:1) and another type that flows in the physical realm, in the rivers and streams of earth.

This firmament also presents the image of a "physical body," that has a covering of skin. The body's skin separates the waters underneath the skin (inside of the body) from the waters (atmosphere) outside of the body. 

A likeness of this firmament can be seen in the image of the Molten Sea, described in 1Kings 7:23.
The Molten (or Brazen) Sea was placed in front of Solomon's temple, just to the North and east of the entrance. It was a large circular container shaped like a bowl, and looked like a bisection of the earth. It was made of cast metal, and measured about 15' across. It was filled with water (holding about 500 barrels).

Picture momentarily standing on the Temple's porch roof, above the entrance door, and looking down upon the Molten Sea. It would have been perhaps 50' to the front and right of your position. Think of the thick metal rim as being the firmament surrounding the water. 

The Sea stood on twelve bulls, three facing north, three facing west, three facing south and three facing east. The Sea (circular bowl) rested on top of them, and their hindquarters were toward the center. (The bowl) was a handbreadth (about 7 ") in thickness, and its rim was like the rim of a cup, like a lily blossom. It held two thousand baths. (NIV) 1King 7:25-26

As you look down on the circular bowl held up by 12 bulls; consider these remarks made by the Messiah as he hung from the cross (or stake) and looked down toward the ground;

Be not far from me; for trouble is near; for there is none to help.
Many bulls have compassed (surround) me: strong bulls of Bashan have beset me round (encircled me).


This is a reference to the Molten Sea, which was held up by 12 bulls. Bashan was an Old Testament territory that was known for  it's strong bulls. By making this analogy, Yahuahshua is comparing the the image of the Molten Sea to his body. His body was the firmament (bowl) holding the spiritual water, which is now being poured out.

(The spectators) gaped upon me with their mouths, as a ravening and a roaring lion.
I am poured out like water, and all my bones are out of joint: my heart is like wax; it is melted in the midst of my bowels. My strength is dried up like
(a piece of pottery); and my tongue cleaveth to my jaws; and thou hast brought me into the dust of death. For dogs have compassed me: the assembly of the wicked have inclosed me: they pierced my hands and my feet. I (can count) all my bones: they look and stare upon me. Ps 22:11-17


Adam's body, being uniquely different from a man's body or an angel's body; enabled Adam to exist in and traverse between both the physical and spiritual world. His body served as a doorway to all of the dimensions of the created universe (or multiverse).
This idea of a dimensional doorway is nothing new, especially in our day and time. But in Adam's case, the system needed to make this travel functional was his actual body. This is in contrast to what man is trying to do today; which is to force open the door of separation by a mechanical means, through the use of particle accelerators and super colliders. 

I am the door: by me if any man enter in, he shall be saved, and shall go in and out, and find pasture. John 10:9 (KJV)

Enter into eternal life, and by "wearing" this door (the eternal and glorified body) a person may go in and out of all 12 dimensions of Yahuah's creation, in peace. The last time I looked on line, Particle Physicists was theorizing about the possibility that eleven dimension may exist. I think the scriptures support the existence of twelve dimensions.
In the first place, Yahuah's name alone points to 12 dimensions.
[Hebrew is read from right to left]

  
His name is spelt, YHWH.  Yaw (#3050) Hoo - ah. The "hoo" part of His name (pronounced "who"), is made up of the letters "hay" (H), and "waw" (W), with the vowel point "shoo-rake," which produces the "oo" or "u" sound. "Hoo" is a particle from the verb, "haw yaw" which means to exist. The four letters of His name can be arranged in 12 different ways (shown below);

YHWH, YHHW, YWHH, WHYH, 
WYHH, WHHY, HWHY, HYHW, 
HHWY, HHYW, HWYH, and HYWH.

Each one denotes some aspect of time, with a particle of the verb "haw yaw" (to exist) being present. 

The description of the New Jerusalem given in Rev 21:19, says that its very walls are built upon 12 foundations.

The inter-dimensional doorway is the same one that was closed when Adam (who was immortal) sinned, and transformed himself into a mortal being. He became unable to exist in both worlds. He was reduced to living in the natural (or physical) realm - only. Adam's awareness of all that existed left his consciousness at the same time that he left the presence of Yahuah. Which is why Yahuah had to go looking for him in the Garden of Eden, calling out to Adam, "Where are you?" (Genesis 3:9). 

The first Adam, who did not walk with Yahuah in the Garden of Eden, is in stark contrast to the second Adam, who in the Garden of Gethsemane choose to do His will.

In the extra-Biblical book called, the First Book of Adam and Eve, there are verses that give us insight into how their bodies had changed. These verses are from chapters 4 and 8:

BUT Adam and Eve wept for having come out of the garden, their first abode. And, indeed, when Adam looked at his flesh, that was altered, he wept bitterly, he and Eve, over what they had done. And they walked and went gently down into the Cave of Treasures. And as they came to it Adam wept over himself and said to Eve, "Look at this cave that is to be our prison in this world, and a place of punishment! "What is it compared with the garden? What is its narrowness compared with the space of the other? "What is this rock, by the side of those groves? What is the gloom of this cavern, compared with the light of the garden? "What is this overhanging ledge of rock to shelter us, compared with the mercy of the Lord that overshadowed us? 

In this book, Adam and Eve are told by Yahuah that they must leave the garden and live in the "Cave of Treasures." Adam considered this cave to be a prison, with an overhanging ledge of rocks. What comes to my mind is a picture of how Adam and Eve's consciousness  and cognizance was changed from a higher spiritual level, to a level that operated only within their natural five senses.

Illustrated below is the archaic (or ancient) version of the Hebrew letter, "R." Hebrew is written using an alphabet, and not pictographs or hieroglyphs. All Hebrew letters have a name, and a word meaning. The name for the Hebrew letter "R" is "Resh" and it means. "the mind." It look similar to a pennant on a stick, but it also resembles the side view of a person's head, which alludes to its meaning, "the mind."



Is this what is meant by the Cave of Treasures? The place where Adam and Eve descended to, living in the cavern of their own skulls, left only to reason within their minds. Having their entire perspective changed from an all encompassing view of Creation and its Creator, to merely peering out from under the ledge behind their own two eyes. 

This is the cave where the first Adam lived, where he died, and where he was buried. A pitiful end to such an extraordinary beginning. 
Yet, our joy and consolation comes from the fact that the second Adam, our Messiah,  walked out of this cave when he was resurrected.
He restored our spirituality and healed the breech that existed between our physical and spiritual self.
Thanks be to Yahuah!

 Adam goes on to lament:

" {Eve}Look at your eyes, and at mine, which before beheld angels praising in heaven; and they too, without ceasing. But now we do not see as we did; our eyes have become of flesh; they cannot see like they used to see before." Adam said again to Eve, "What is our body today, compared to what it was in former days, when we lived in the garden?" Chapter 4:8-10

Then Adam cried and said, "O Yhwh, when we lived in the garden, and our hearts were lifted up, we saw the angels that sang praises in heaven, but now we can't see like we used to; no, when we entered the cave, all creation became hidden from us."

The door that Adam and Eve closed, the one that forced them to live outside of the garden; is the same door that was reopened by our Messiah (Mashiyach), when he inherited His eternal body;

By faith we understand that the worlds [plural, the spiritual and physical realms] were framed by the word of Yhwh,.......... Heb 11:3 (NKJ)

He made a specific type of creature to live in each one of these worlds, in each respective environment. 

There are also celestial bodies and terrestrial bodies; but the glory of the celestial is one, and the glory of the terrestrial is another. 1 Cor 15:40 (NKJ)

Yhwh made terrestrial beings (mankind) to live upon the earth, and celestial beings (the angels) to inhabit the heavenly realm. On the second day of Creation, suppose for a moment that Yahuah took from both elements; the terrestrial (dust of the world) and the celestial (spirit from his breath) and created one unique individual; to reign with him over his creation.  Just as Pharaoh gave Joseph his signet ring, he also clothed him in garments of fine linen, placed a gold chain around his neck and gave him rule over Egypt. In like manner Adam was placed in authority over all of Yhwh’s creation. Adam was not a mere man, though he was made of flesh and bone; nor was he an angel or spirit being (alone). 
Look at these scripture verses from the two Creation accounts of Genesis chapter 1 & 2. They draw a distinction between the two different creatures; Adam and then "mankind." In the second creation story [Genesis 2:7] the Hebrew words convey the idea that Yahuah  "formed" [Hebrew word, yatsar] and  squeezed Adam into shape; molding him as a potter moulds his clay. Then He breathed into Adam his holy spirit (ruach hakodesh). 

In contrast to this description, on the sixth day [Genesis 1:26] Yhwh says:

"Let us make man [mankind] in our image [the Hebrew word "tselem" meaning; a phantom, an illusion] after our likeness... [meaning, resemblance]."

This man; the Hebrew common noun "adam" being used (and meaning mankind) is created male and female. The Hebrew word used here for male is "zakar," and the word for female is "neqebah." Those words are also used of male or female animals (quadrupeds).
In contrast to "zakar" and "neqebah;" Adam is called (in Hebrew), 'iysh (eesh); a man as an individual or a male person. Eve is called ishshah (ish-shaw'); a woman.

In Genesis 1:29 Yahuah says to mankind (during the sixth day):

"See, I have given you every herb that yields seed which is on the face of all the earth...."(for food)

In Genesis 3:18 Yahuah tells Adam - after - he had sinned; that the ground would be cursed: 

Both thorns and thistles it shall bring forth for you, and you shall eat the herb of the field. (NKJ)

If Yahuah had already given Adam the herb of the field to eat in Gen 1:29, why was he telling him now (In Gen 3:18) that he will eat it as one of the consequences for his sin?
Could it be that mankind lived by eating fruits and herbs; and Adam lived by means of some other sustenance? Namely, an energy source given to him that came directly from Yahuah?

"In the mean (time) while his disciples prayed him, saying, Master, eat. But he (Yahuahshua) said unto them, I have meat to eat that ye know not of." John 4:31-32

Genesis 1:24 (the sixth day) begins with;

And Yhwh said, Let the earth bring forth the living creature after his kind, cattle, and creeping thing, and beast of the earth after his kind: and it was so. And Yhwh made ( the Hebrew word "asah" meaning to do or make] the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and Yhwh saw that it was good. And Yhwh said, Let us make [asah] man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth. (KJV)

In this account, the Hebrew word, "'erets" [the earth or land] is bringing forth living creatures simultaneously, as Yahuah is commanding them to be made. Mankind, like the other living creatures, is being made or  "called forth" from the ground.

Yahuahshua later testified that this is something which Yahuah is quite capable of doing.

"And think not to say within yourselves, We have Abraham to our father: for I say unto you, that Yhwh is able of these stones to raise up children unto Abraham." Matt 3:9

Adam's body was made of flesh and bone with a "spiritual water" inside that I'll call "plasma" (for now). He possessed an immortal body that was not subject to decay. Bear with me as I  differentiate between "mortal" blood and "immortal" plasma. I'll go into the biological differences later on. 

Adam was given a covering of light, just as Yahuah uses light as a covering for himself.

"Bless YHWH, O my soul! O YHWH, You are very great: you are clothed with honor and majesty, Who cover Yourself with light as with a garment,..." Ps 104:1-2

Yahuah's pure energy produces this light, and it was the source of life for Adam. Adam did not need to eat of the herb of the field, or of the fruit from any tree. In fact, if you look at Genesis 2:16, when Yahuah enjoins Adam to eat of every tree in the Garden, the word "fruit" is not even mentioned by Yahuah. Adam existed by means of a continual power source (or energy) from Yahuah himself.
This makes me wonder, in relation to his physiology,  why would he need all of the internal organs we have now? Organs whose primary function is to filter out impurities and supply oxygen to the brain. 
Yahuah had breathed his Spirit directly into Adam's nostrils, and gave him a part of his self existent energy which clothed him in a covering of light.
This energy field is the same one spoken of in the first day of creation, when the spirit of Yahuah moved upon the face of the waters and said (in the Hebrew),

"Energy - exist !"

This is a much better translation than the current English one found in most Bibles which says "Let there be light." The word for light in Hebrew (Oyr) is usually translated as "lightning." A modern term for this word is "energy," especially electro magnetic energy. The energy he created as he moved upon the face of the waters also resulted in the magnetic field of the earth. Without this magnetic field, life on this earth would not exist. All of the neurons firing in our brains need a magnetic field in order to work. Without the magnetic field around the earth, we would be bombarded by radiation from the sun. Without the energy field around Adam, the intimate life source from Yahuah would cease. Adam and Eve were both naked under this covering of light, yet they were not ashamed. The covering of light was their garment.
Once they had sinned, their covering of light departed from them, and they realized they were naked. Even after they had covered themselves with fig leaves, they hid from Yahuah because they considered themselves even still,  to be naked. Obviously this type of nakedness means much more than just being without clothes. It means the glory of their covering was gone, and their sin was exposed. Just as Samson was separated from Yahuah, losing his extraordinary strength and power because he broke his vow. So did Adam and Eve descend from their first estate into the animal world of flesh and blood.

Forasmuch then as the children are partakers of flesh and blood, he (Yahuahshua) also himself likewise took part of the same; that through death he might destroy him that had the power of death, that is, the devil; Heb 2:14 (KJV)

The English phrase "Forasmuch then" means "because of the fact that." 
At first glance, this wording is unusual. What do the scriptures mean by saying, 

"because of the fact that the children have partaken of flesh and blood," the Messiah (Mashiyach) had to come and partake of the same (flesh and blood).

Didn't the children always have flesh and blood? Isn't that the way they were made from the beginning? The answer is no. It was Adam and Eve that changed their physiology and became flesh and blood (a certain type of flesh and blood). In doing so, they forced their children to be born into a body of flesh and blood. The stark reality of this occurrence is presented in the following circumstances:

Once Adam and Eve changed their physical form, and in order to survive in this new physical state;

Yahuah made garments of skin for Adam and his wife and clothed them. Gen 3:21

By making "garments of skin," does this mean that Yahuah slaughtered several animals, skinned them, tanned their hides, made some thread, and then sewed some type of buckskin clothing together? I can't picture this at all! 
I think the "garments (or coverings) of skin" being referred to here are the epidermal (or outer) layers of human skin. Without their covering of light, Adam and Eve were not prepared to physically exist in the natural world. Before they sinned, they did not have the same body that we have now.

There are, in the scriptures, symbols and glimpses of the original covering of light that once covered Adam and Eve's body. Joseph's "cloak of many colors" was a likeness this covering; and used to symbolize position and power. 

The High Priest's breastplate was covered in twelve gem stones. Each one was of a different color, and represented one of the twelve tribes. Placed next to one another, these individual colors actually represent the (electro-magnetic) spectrum of white light. 

To be in the presence of Yahuah is to be in the presence of His light. Moses experienced this when his face shinned brightly after he had talked to Yahuah face to face. It was radiant. (Ex 34"30)

A glimpse of this covering of light-energy can also be found on the Mount of Transfiguration, when Yahuahshua is seen by several of His disciples, standing next to Moses and UliYawHu, covered in light. 

I suspect that Adam and Eve's covering of light, although no longer present at this point, had a residual affect on their two offspring, Cain and Abel. This residual effect will also play a part in the last days, during the reign of the Son of Perdition. When he will appear like his father Satan, who himself;

"....is transformed into an angel of light." 2 Cor 11:14 (KJV)

It was sin that caused Yahuah's light to be removed from Adam and his wife. Paul understood the nature of Adam and Eve’s sin, and hidden in the epistle to the Romans (Chapter 1) is the deeper meaning of his writing [my remarks in brackets]:

"For the wrath of Yhwh is revealed from heaven against all (wickedness) and unrighteousness of men, who hold the truth in unrighteousness; Because that which may be known of Yhwh is manifest in them; for Yhwh hath shewed it unto them. For the invisible things of him from the creation of the world are clearly seen, being understood by the things that are made, even his eternal power and divine nature; so that they are without excuse:  
Because that, when they
[Adam & Eve] knew Yhwh, they glorified him not as their Ul (Mighty One)...

 
[Did Adam or Eve ever glorify Yahuah, or ask for forgiveness?] 

...neither were thankful... 

[is there any declaration of praise made in Yahuah's favor, from Adam or Eve?] 

...but became vain in their imaginations, and their foolish heart was darkened. Professing themselves to be wise...

[by deciding to eat the fruit of the tree that makes one wise] 

...they became fools,
And changed the glory of the uncorruptible Yhwh... 

[his covering of white light and energy] 

...into an image
[a body] made like to corruptible man, and to birds, and fourfooted beasts, and creeping things [everything of the animal kingdom].  
Wherefore Yhwh also gave them up to uncleanness through the lusts of their own hearts, to dishonour their own bodies between themselves
[they committed adultery]:  
Who changed the truth of Yhwh
(the nature of his self-existence, seen in their bodies of light) 
into a lie
(a counterfeit reality where Yhwh is not glorified)
and worshipped and served the creature (the carnal lusts of their five senses) more than the Creator, who is blessed for ever. Rom 1:18-25 (KJV)

Adultery is the sin that changed their bodies, and caused them to be separated from Yahuah. 
Who with? I'll explain that momentarily. The scriptures make an important distinction between adultery and all other types of sin.

"Flee from sexual immorality. All other sins a man commits are outside his body, but he who sins sexually sins against his own body." 1 Cor 6:18 (NIV)

When Adam and Eve sinned against their own bodies; there covering of light left them, and their nakedness was exposed.

Adam’s Rule

Yahuah showed Adam how creation came into being, and gave Adam rule over his creation. Yet there was no one like him, he was alone.

"And Yhwh said, It is not good that the man should be alone; I will make him an help meet for him." Out of the ground Yhwh formed every beast of the field and every bird of the air, and brought them to Adam to see what he would call them. And whatever Adam called each living creature, that was its name. Gen 2:19 (NKJ)

Take notice that in these two verses (Gen 2:19-20) Yahuah has a dual purpose in mind;

1. For Adam to find a mate suitable for him (so that he should not be alone).
2. To place Adam in legal authority over his creation, in front of the inhabitants of His creation, including his heavenly counselors and angels.

The naming of each "living creature" is usually interpreted by Bible scholars to mean animals (quadrupeds) and birds. They interpret these verses to mean that Yahuah brought lions, tigers, bears, owls, and a host of other creatures before Adam for him to name. But, consider this, if Adam is naming biological families and species of the creatures on earth (to which he was given dominion) where are the sea creatures and creeping things? Why are they are not present? Why doesn't this event take place along the seashore? The scriptures say in Genesis 1:26 specifically that Adam had dominion over the sea creatures and creeping things. Are they just unimportant and don't require a name?
The absence of this large segment of creatures gives us a clue as to the true nature of this event. 

Look at the Hebrew word for "name," which is, "shem" [#8034]. It means, "a name" with the idea of a definite and conspicuous position; an appellation, as a mark or memorial of individuality.

By definition, "shem" means a personal name, and not the names of biological families and species of creatures. I don't picture a procession of animals passing by Adam with him saying; OK, you're Tony the tiger and you're Bobby the bear.; and the cute one over there is Debbie the duck. 
Especially when the scriptures say that during the naming of these creatures;

"...there was not found a helper comparable to him [Adam]."

Since the stated purpose for this procession was to find a helper (a wife) for Adam, why would Yahuah parade a host of four legged animals and birds before Adam and expect him to find a mate? That interpretation doesn't make sense.

Read the next verse, with an alternative interpretation in the brackets;

So Adam gave names to all cattle (the collective peaceful creatures), to the birds of the air (the angels) and to every beast of the field (mankind). Gen 2:20 (NKJ)

Rather than naming families and species, Adam gave each individual man and each angelic being an appellation; a personal name. The act of giving someone a name denotes that the person being named is lower in rank or position than the person who is giving the name. The words "lower in rank" or "position" have no bearing on a person's uniqueness, qualities, or individuality. It does have a bearing on the role you are given to perform, in regard to your duties and obligations. We all have roles that we maintain in this life; as a husband, wife, father, mother, brother, sister, employee, or employer, etcetera. This does not mean that experientially our joy in life would be greater if we had a different rank or position. Yahuah is able to completely fill our joy. These positions and duties were selected by Yahuah to fulfill a purpose in service to Him. 

Present at this ceremony is each of the three types of beings, who were all of the same family; Adam, angels, and man. Yahuah had a dual purpose in having Adam name all of the creatures he made, in front of His entire creation. The first one was to authenticate Adam's position. Just as Pharaoh did for Joseph by elevating him to the position of "Co-Regent," in a ceremony that took place with all of Egypt's officials and administrators in attendance. The second reason was to show Adam that among men and angels, there was no one like him, he had no counterpart. There did not exist among the angels or mankind, someone suitable to be his wife.
This must have been apparent to Adam. Because in the next verse, Yahuah causes a deep sleep to fall upon Adam, for the purpose of making his wife. I don't see Yahuah zapping Adam or knocking him out with some anesthesia without his permission. Adam submitting to this willing because Yahuah his Father, told him that he would create his perfect counterpart with a substance taken from his body.

And Yhwh caused a deep sleep to fall upon Adam, and he slept: and he took one of his ribs, and closed up the flesh instead thereof; Gen 2:21 (KJV)

The Hebrew word "tsela`" [#6763] from which the King James translators interpreted to mean "rib" actually means; "a curve, or "to curve."" 
The word rib would be an adequate assumption for someone to make in the 16th Century; but for us, the curve of the double helix of DNA would be a better choice. 

Shown below is the ancient Sinaitic script, which is the earliest known form of the Hebrew letter "hayt (chet)."

 

Sinaitic script   Paleo Hebrew Modern Hebrew


This is the "curve" Yhwh took from Adam to make his wife. From his genome (genetic code) Yhwh would design his counterpart. Someone comparable to him (meaning alike). In the Hebrew aleph-bayt , each letter has a name, a sign (or word meaning). The "Hayt" means "fence" or "ladder." 
The double helix is the ladder, and the genes which make up a certain chromosome could be called "the fence."  A fence that was purposely designed to preserve the order of Creation, by safeguarding reproduction, so that each living thing reproduces according;

"....to its own kind." (Genesis 1)

The Creator did not want his creation to be subjected to genetic mutations that would alter  the integrity and purpose of everything that exists.

When Yahuah presented Adam's wife to him, he said,

"This is now bone of my bones, and flesh of my flesh: she shall be called Woman, because she was taken out of Man." Gen 2:23 (KJV)

Using Joseph as an example once again, a likeness of this event can be seen when Pharaoh elevated Joseph to co-Regent, and presented him with a wife (Gen 41:45). Joseph didn't choose this woman to be his wife, instead he yielded to Pharaoh's wishes (and judgment). 

Eve was of the same bodily form as Adam, because she was made from the same genetic material that Adam was made from. Adam and his wife were one,
Notice that Adam did not give his wife a name, but said rather;

...she shall be called Woman, because she was taken out of Man. Gen 2:23 (KJV)
 
There is a curious aspect to Adam's statement that I'd like for you to keep in mind. Why did he say, upon seeing her for the first time, "she shall be called woman."  Why doesn't he say instead, "she is my wife?" And then give her a name. After all, Yahuah didn't call him by the name, "The Man." His name was "Adam."
 
Was Adam, for some reason, reluctant to accept Eve's status as his wife?

Only after they had sinned did Adam name his wife "Eve." [Genesis 3:20] 
Only after Yhwh had said to the woman:

"...Your desire will be for your husband, and he will rule over you." Gen 3:16 (NIV)

This statement leads to another question; If her desire from this point on would be for her husband, who did she desire previously?
If Adam questioned Eve's status as his wife, wasn't he in fact questioning Yahuah's ability to make him a perfect mate? If Adam was refusing Eve's status as his wife, was there someone else that he desired?

Placing those questions aside for a moment, there are now two unique beings; made of spiritual water (plasma) and the Spirit. Not terrestrial alone, or a spirit being only. The scriptures make a distinction:

Hamashiyach answered, "Most assuredly, I say to you, unless one is born of water and the Spirit, he cannot enter the kingdom of Yhwh. "That which is born of the flesh is flesh, and that which is born of the Spirit is spirit. John 3:5-6

Yahuah intended for Adam and his wife to be living examples of how to lead a righteous life. To live in agreement and harmony with the will of Yahuah. That was the choice before them. They were to be leaders before mankind, so that mankind would emulate their example as husband and wife.

If Adam and Eve had each accepted their status as husband and wife, and eaten from the tree of life, they would have brought about the Kingdom (reign) of Yahuah. Instead they gave up their authority to Satan, who ushered in a different kingdom, a counterfeit reality. 

"For this purpose the Son of Yhwh was manifested, that He might destroy the works of the devil." I Jn 3:8 (NKJ) 

[The fruit of Satan's work being his counterfeit reality.]

Once Adam and his wife fell from their first estate, and the chaotic conditions of the counterfeit reality began, there was no role model or living example as Yhwh intended. This was the beginning of lawlessness. Many years later, in order to fill this void, and as a substitute for the living example of Adam and his wife, the Hebrews would receive the 10 commandments (or the 10 words).

The 10 Commandments are a picture of Adam and Eve. The two stone tablets were written on the front and the back; which is quite different from how they are usually depicted, with all of the words being written on the front side only. By writing on the front and back of the tablets, we are being shown that these two tablets are three dimensional, just as Adam and Eve were three dimensional beings.
Notice that - The first two stone tablets (and ONLY the first two tablets) given to Moses were hewed (made) by the hand of Yahuah and not by man. In the same way, Adam and Eve had the distinct honor of being made or actually squeezed into shape by the hands of Yahuah, as opposed to being "brought forth" from the earth, as mankind was on the sixth day of creation. 

The first two stone tablets were broken into pieces by Moses when he came down from Mt. Sinai, to witness the Hebrews worshiping the golden calf. This sin is referred to in the scriptures as being the spiritual equivalent of committing adultery. In like manner, the bodies of Adam and Eve were "broken" by sin, and became mortal, once they ate from the tree of knowing evil. The Hebrew root word for evil, "ra` a`" means to spoil by literally breaking into pieces.

[This reference to the word evil, meaning "to spoil" brings us back to "binding" the strong man, so you can spoil his goods. Satan spoiled the strong man's goods by enticing him and his wife to commit adultery, thereby introducing mortality.] 

Once the original two tablets made by the hand of Yahuah were broken
, two replacement tablets were hewed by the hand of Moses.

This symbolizes the two bodies of Adam and Eve that were originally made by the hand of Yahuah, but were transformed by sin and made into the image of man. In like manner, the second set of tablets were carved and shaped by the hands of Moses. 

The ark of the Testimony is a picture of the womb. A womb that holds a promise from Yahuah that one day from Eve's posterity, the Messiah would come forth. Moses is instructed by Yahuah to place the two broken tablets, representing the original immortal bodies of Adam and Eve, inside of the ark. The ark itself is symbolic, being made of wood, and overlaid with gold (as described in Exodus 25:10-11) The wood symbolizes the body of flesh and bone, and the gold overlay symbolizes the covering of light originally given to Adam and his wife. These two tablets were being held in preparation, in the hope

"... of eternal life, which Yhwh, who cannot lie, promised before the world began;" Titus 1:2 (KJV)

There were two Cherubim that kept watch over the mercy seat, which was placed on top of the ark of the Testimony. (as shown in the diagram below).

"And the cherubims shall stretch forth their wings on high, covering the mercy seat with their wings, and their faces shall look one to another; toward the mercy seat shall the faces of the cherubims be. And thou shalt put the mercy seat above upon the ark; and in the ark thou shalt put the testimony that I shall give thee. Exod 25:20-21

 


The two cherubim are guarding the immortal life genome present in the "seed" of Eve, until the appointed time when Messiah would come.
The scripture verse shown below gives us a special insight into the person of Messiah, who is (in a real sense) present in the seed of Eve, as it is passed down through her descendants. He is the Messiah who dwells between the cherubim, in the ark (womb) of the testimony. 

Give ear, O Shepherd of Israel, you who lead Joseph like a flock; you who dwell between the cherubim, shine forth! Ps 80:1(NKJ)

When Yahuahshua had offered his own body unto death, it was placed on a stone table inside of Joseph of Arimathaea's  tomb, just as if it had been placed on the mercy seat on top of the ark of the testimony.
The two Cherubim faithfully guarded the contents of the ark until the appointed time, the conception of Messiah.  After His resurrection, when Mary Magdalene looked inside the tomb she saw:

..... two angels in white sitting, one at the head and the other at the feet, where the body of Yahuahshua the Messiah had lain. John 20:12

These two angels were the two angels that previously stood guard over the mercy seat in the temple. Only now - they are seated! Their watch is over, their work is done, The Messiah has risen! These are the same two angels that tore the temple veil from top to bottom, on their way out of the Holy of Holies. 

"But as many as received Him, to them He gave the right to become children of  Yahuah, to those who believe in His name: who were born, not of blood, nor of the will of the flesh, nor of the will of man, but of Yahuah. John 1:12-13 (NKJ)

Adam had a sacred duty.

Yhwh took the man, and put him into the garden of Eden to dress it and to keep it. Gen 2:15(KJV)

The Hebrew word for "dress it" (abad) means, to work and to serve.
The Hebrew word for "keep it" (shamar) means, to guard and protect.

In Joshua 22:27 the word "abad" is translated "to serve" (or render service). Translating "abad" with the word "work" is more of a Western idea than an Eastern one. To the ancient Hebrew mind, to work and serve is one and the same thing. Adam was entrusted to serve; by guarding and protecting the Garden of Eden. In the Garden of Eden, there was also a guardian cherub. He was the highest in order (or rank) among the angelic beings.

....."You were the seal of perfection, full of wisdom and perfect in beauty. You were in Eden, the garden of Yhwh; every precious stone was your covering: the sardius, topaz, and diamond, Beryl, onyx, and jasper, sapphire, turquoise, and emerald with gold. The workmanship of your timbrels and pipes was prepared for you on the day you were created. "You were the anointed cherub who covers; I established you; you were on the holy mountain of Yhwh; you walked back and forth in the midst of fiery stones. Ezek 28:12-14 (NKJ)

According to the scriptures, this cherub was perfect while he was in Eden and not in a sinful state. This is contrary to what many teach. They believe that Yahuah put this cherub (Satan) in the Garden, while he was in an evil state of rebellion, for the sole purpose of tempting man. But is this true? 

"Let no one say when he is tempted, "I am tempted by Yhwh"; for Yhwh cannot be tempted by evil, nor does He Himself tempt anyone." James 1:13(NKJ)

"You were perfect in your ways from the day you were created, till iniquity was found in you." Ezek 28:15 (NKJ)

This cherub was also given a sacred duty, which was "to cover:" (cakak) meaning to fence in, cover over, (figuratively) protect. 

In Ezekiel 28:12-14, this cherub (Satan) is covered with 9 gem stones. These gem stones are related to his covering of light, just as Adam and his wife were covered in light.

Compare the nine gem stones given to the guardian cherub, to the breastplate of the High Priest which was covered with 12 gem stones (shown on the chart, the Spectrum of White Light). 


The Guardian Cherub of Ezekiel 28:13 was given these nine gemstones:

ruby, topaz, emerald
chrysolite, onyx, jasper
sapphire, turquoise, beryl

The High Priest's Breastplate of Judgment ( Exodus 28:17) had these 12 gemstones

ruby, topaz, beryl
chrysolite, onyx, jasper
turquoise, sapphire, emerald
jacinth, agate, amethyst.

Satan projected a different covering of light, one that was less brilliant when compared to Adam's covering. This demonstrates that Satan was of a lower rank than Adam. It also reveals why Satan could not have overpowered Adam by force. 
The three gems stones not given to the guardian cherub (Satan), but present on the breastplate of Judgment, and present in the spectrum of white light, are shown below in their usual colors:


Jacinth Blue


Agate Purple

Amethyst Scarlet

Blue, purple, and scarlet.
These colors are the priestly colors.
These gemstones represent the colors of the garments the High Priest wore. A robe of blue, with an ephod (vest) worn over the robe. The ephod was made of fine linen interwoven with threads of pure gold and other threads that were blue, purple, and scarlet in color.

And they made upon the hems of the robe pomegranates of blue, and purple, and scarlet, and twined linen. Exod 39:24 (KJV)

Satan was not the High Priest. The High Priest is a picture of the first Adam in his role as chief administrator for Yahuah. The breastplate of judgment can also be translated as the breastplate "for making decisions" or "right rulings," in the same way a judge considers and contemplates his decision. The first Adam failed to judge rightly and betrayed his Creator. Whereas, the second Adam judged rightly, and in doing the Father's will, perfected the work of the High Priest.

The guardian cherub, this enlightened creature full of wisdom, conspired in the Garden of Eden (going thru Eve) to overthrow Adam's rule. So that he could not only spoil Adam's house ( and his lineage) but Yahuah's entire Creation. All of this happened with Adam's full and complete knowledge of the circumstances. Sound crazy? Compare Adam to the mighty and powerful Samson. His wife Delilah was motivated  by power and greed. She conspired with the Phillistine Captains to discover the source of Samson's power. She did this so he could be overthrown by his enemies. Samson wanted Delilah, a Phillistine woman, even though he was forbidden to marry anyone other than a Hebrew. Samson, like Adam, wanted something he was not supposed to have. Adam looked the other away while his wife ate the fruit from the tree of knowing evil. But Adam himself, was not deceived.

And Adam was not deceived, but the woman being deceived, fell into transgression. 1 Tim 2:14 (NKJ)

Since Adam was not deceived, he must have known exactly what was happening.
Adam and Satan, the ones who were empowered to guard and protect creation. committed treason against Yahuah by altering the order of creation. Adam was fully cognizant of what was going on. 

The word "iniquity" from Ezekiel 28:15, is defined as a violation of duty, a wicked act, or depravity. The guardian cherub used his wisdom, power, and position against Yahuah; and only he could have done it. When Yahuah asked Adam if he ate of the tree of knowing evil, Adam blamed Eve. When Yahuah asked Eve "what have you done?" she blamed the serpent. Yahuah didn't asked the serpent "what have you done?" because he already knew that only the serpent (Satan) could have betrayed him in this manner.


Yahuah called to Adam saying;

"Where are you?" He answered, "I heard you in the garden, and I was afraid because I was naked; so I hid." And he (Yhwh) said, "Who told you that you were naked? Gen 3:9-11 (NIV)

What does Yahuah mean by, "who told you that you were naked?" Why would Adam have to be told? Didn't he know that under his covering of light, he was naked?  
Who else could have told Adam he was naked? No one but the angels saw how Adam was made. If there was anyone at all, who saw Adam's form before he was covered in light, it was the angels.
Did Satan somehow use this information to help persuade Eve? 
The scriptures say that Satan was full of wisdom, so I don't see any reason why Eve would not have trusted him as a friend. Satan is described as being in the Garden of Eden in a perfect state, so this leads me to believe that he transgressed at the same time as Adam and Eve. This would mean that the fall of creation was a cataclysmic event! Adam and His wife, mankind, Satan, and the fallen angels, all choose rebellion - at the same time! 
This is what Yahuahshua meant when He said;

"I saw Satan fall like lightning from heaven." Luke 10:18 (NIV)

This saying is in the past tense. He is referring to earlier point in time when Satan was cast out of the Garden of Eden. This is not a reference to the future event recorded in the Book of Revelation when Satan is cast down to the earth.

Notice that after Adam was sent out of the garden, Yahuah placed

.......at the east of the garden of Eden, Cherubims, and a flaming sword which turned every way, to keep the way of the tree of life. Gen 3:24 (KJV)

The verb "to keep" used above, is the same Hebrew word meaning "to guard and protect." Why was it necessary for Yahuah to place guardian cherubs at the east side of the garden of Eden, at this point in time? Because the one who was originally placed there (Satan) committed sin and was thrown out of his post.


Here is a likeness or "picture" of what took place in the garden.
In Genesis chapter 15 Yhwh promises Abram to bring forth an heir from his own body. In Chapter 16, Sarai, not willing to wait on the promise and having a carnal plan to bring forth children through her maidservant Hagar, tells Abram "....go into my maid."

And Abram heeded the voice of Sarai. Gen 16:2 (NKJ)

Hagar conceived by Abram and gave birth to Ishmael.
Adam also heeded the voice of his wife:

"..she took of its fruit and ate. She also gave to her husband with her, and he ate. Gen 3:6 (NKJ) 

Yahuah then said to Adam,
"Because you have heeded the voice of your wife, and have eaten.......... Gen 3:17 (NKJ)

Both Adam and Abraham heeded the voice of their wife, instead of waiting on the promise of Yahuah. 
In the same way Samson, who was "set apart" to Yahuah by a Nazarite vow, chose a Delilah to be his wife. Her name in Hebrew means, pinning with desire, or lustful. Three times Delilah called in the Phillistine Captains to capture Samson. His secret, if known, would be his undoing. Yet he heeded the voice of his wife. He told her what the source of his great strength was even though he knew she would betray him. The Phillistines subdued him and put out his eyes. Samson went from being a mighty man of Yahuah, to a weak, sightless, grinder in a prison.  Just as Adam lost his power and authority, becoming mortal and weak; losing his spiritual "eyes" (or insight). He became a prisoner to his five senses; reduced to subsisting from the produce of the ground, and imprisoned by the need to maintain a full stomach.

What caused this?

Adam, who was immortal, and should not have died, would not eat of the tree of life, and gain eternal life. He did not heed the voice of Yahuah.
It was Yahuah's will for Adam and his wife to believe first, that He was Yahuah, the author and sustainer of life. There is no other besides Him. In the same way, all three patriarchs; Abraham, Isaac, and Jacob had to come to this same understanding, that Yahuah alone is the author and sustainer of all life. All three men married women who were barren. Each man had to believe by faith that only Yahuah could bring forth children. That no matter how many times a man and his wife have sexual relations, only Yahuah can make the womb fruitful.

Neither shall thy name any more be called Abram, but thy name shall be Abraham; for a father of many nations have I made thee. Gen 17:5 (KJV)

Abraham, believing by faith, accepted a name that meant "father of a multitude" before Sarah gave birth to their son Isaac.

Now Isaac pleaded with Yhwh for his wife, because she was barren; and Yhwh granted his plea, and Rebekah his wife conceived. Gen 25:21 (NKJ)

Isaac believed, and his prayer was answered. 
When Rachel: said to Jacob, "Give me children, or else I die." Jacob responded;

......."Am I in the place of Yhwh, who has withheld from you the fruit of the womb?"
Gen 30:2 (NKJ)

Jacob also knew that only Yahuah could create life. In the same way, Adam and Eve needed to believe Yahuah for who He is, and choose to eat from the tree of life. Most English versions of the scriptures say that,

Yahuah "commanded" the man saying,  Of every tree of the garden thou mayest freely eat:, except for the tree of the knowledge of good and evil. [Gen2:16-17]

The Hebrew word being translated as "commanded" actually means "to enjoin;" or "bid to join."
Yahuah enjoined the man to eat "of every tree" (except the tree of knowing evil). Was not the Tree of life included in the description of "every tree of the garden?"

The tree of life was also in the midst of the garden,.........Gen 2:9 (NKJ)

It was! But for some reason, right up until the point when they both sinned, Adam and Eve did not eat of the tree of life; neither did Eve bare any children. So I believe that Eve, like Sarah; developed a carnal plan to have children. The serpent who talked to Adam's wife (in the garden) was a human man, of the 6th day creation. 
The Hebrew word used for serpent is "nachash" [#5175] and means a snake (from its hiss); but it is also a proper name, as shown below from Strong's concordance:

[Nachash (naw-khawsh'); #5176 the same as #5175; Nachash, the name of two persons apparently non-Israelite]

His personal name, "Nachash" taken from the root word (snake) means to whisper or cast a magic spell, and to prognosticate. This is exactly what Nachash did to Adam's wife. As I stated earlier, I believe this was a work in progress; and that Nachash and Adam's wife were friends. Just consider the ease at which they discussed overthrowing Yahuah's creation by committing sin. Even if someone is inclined to do evil, that's hardly the topic you discuss when you first meet someone.
At the same time, Eve was not someone lacking in intelligence or wisdom. She was persuaded in part because she was
already contemplating sin in her own mind; as the scriptures indicate;

"........Yhwh made to grow every tree that is pleasant to the sight, and good for food; the tree of life also in the midst [center] of the garden, and the tree of knowledge of good and evil." Gen 2:9 (KJV)

Notice that Yhwh made the trees first; pleasant to the sight [spiritually pleasing] and then secondly good for food (physically satisfying).  But when Eve looks at the same trees, she sees them in the exact opposite way;

"So when the woman saw that the tree was good for food, that it was pleasant to the eyes, and a tree desirable to make one wise, she took of its fruit and ate." (NKJ) Gen 3:6

Eve was already looking at this tree with desire. She convinced herself that the fruit from the tree was physically satisfying, nice to look at, and had something extra to offer - an experience!  
It appears that Eve allowed her own desires, to lessen the consequences for eating from the tree of knowing evil.

Adam was told:
"you will surely die."
Gen 2:17 (KJV)

But Eve said to Nachash,

"..Ye shall not eat of it, neither shall ye touch it, lest ye die." Gen 3:3 (KJV)

Eve said, "lest ye die:" meaning that you could or might die

Now, either Adam told Eve exactly what Yahuah had said in Genesis 2:17, and she changed the consequences from "surely die" to "might die," or Adam lied to Eve and told her that she "might die" when he knew that Yahuah said, you will "surely die." After all, the scriptures only record what Yahuah said to Adam, and we are left to assume that Adam communicated those exact words to his wife. What makes me suspect that he might have lied to her is the added phrase "neither shall ye touch it," which was not part of Yahuah's original statement. The Hebrew verb naga` (naw-gah') which means "to touch," is also a euphemism for sexual intercourse ("to touch" as in "to lie with a woman"). Interestingly enough it is also the root word for "Na-chash" which is the name of the man who is talking with Eve. 
The evidence points to Adam's wife having sexual relations with a human man. Eve took of the fruit first, with her husband standing right next to her.

.......she took of the fruit thereof, and did eat, and gave also unto her husband with her; and he did eat. Gen 3:6 (KJV)

Then Adam did the same with a female member of the human race, most likely the person Adam wanted all along. She might even have been the wife of Nachash. This is probably where the ancient Hebrew story of Lillith originates from. Although it has been distorted over the years, there is an ancient Hebrew legend that Adam's first wife was named Lillith. Whether that is true or not, there exists a strong possibility that Adam rejected Eve as his wife because he desired another. Before Eve was made, and at the time that Adam was naming all of the creatures, he could have met Nachash's wife and desired her?
This is all speculation, but what is openly expressed in the scriptures, can lead to some questions about what is implied in the circumstances.
If Adam wanted Nachash's wife, he could have allowed his wife (Eve) to be lead into sin. The scriptures allude to the fact that Adam never consummated his marriage with Eve, prior to the time when they both sinned.

Now Adam knew Eve his wife, and she conceived and bore Cain, and said, "I have acquired a man from the LORD." Gen 4:1 (NKJ)

This verse from Genesis 4:1 begins with the imperative "Now," denoting place and time of origin. In other words, beginning at this point in time, is when Adam first had sexual relations with his wife Eve.
Why did he wait until now? Why did he with hold this from her? The most logical answer is, because he wanted some one else. Adam could have actually helped to engineer the circumstances behind his wife's interest in another man. This is most likely why Eve (like Abraham's wife, Sarah) developed her own carnal plan to have children. Namely because Adam never did "lie with her." Notice that immediately following Eve's adultery Adam had someone right there with him,  whose "fruit" he can partake of. Where did she come from?
It's also interesting to note that once Eve had sinned, Yahuah did not appear on the scene and confront Eve alone for what she had done. He couldn't just make Adam another wife. He waited until they both had partaken of the fruit. Because no matter how Adam and Eve felt about each other, they were both of one flesh; and in the eyes of Yahuah, they were man and wife.
Another question that comes to mind is, if Adam wanted another woman, why did he wait for Eve to eat of the fruit first? Why didn't he just go to be with the one he wanted? I have to wonder, is this why he watched Eve sin first, because he waited to see if she would "surely die," just as Yhwh had said? 
Could he have been that big of a creep? 
Maybe it was Adam that told Eve she "might die." Which would mean that Adam and not Eve, reduced the consequences for sinning, form "surely die" to "might die." Perhaps he did this in order to help Eve along in her sin. Maybe when Adam saw that she didn't immediately die after sinning, he felt like he was in the clear to eat some fruit.
This may be starting to sound like a script from an afternoon soap opera, but I see it as a complicated plot involving at least five persons. None of which are naive, stupid, or easily mislead. What were their motives, and how are we to understand the psychology of the persons involved in these circumstances. Who was the ringleader? Or was there more than one? Was this a conspiracy involving Adam and Satan? Were the others just complacent, or did they get  taken advantage of? 
After all of this had gone down, we do know who Yahuah goes to first;

And YHWH called unto Adam, and said unto him, Where art thou? Gen 3:9 (KJV)

We also have this statement from Yahuah;

"..because you have heeded the voice of your wife,." (Genesis 3:17)

This saying seems to lay the blame directly at Adam's feet; while at the same time it sounds like Eve had a big part in persuading Adam. 
I may not know all of the details behind what happened that day, but the net result amounted to this; everyone wanted something else to make them happy. No one chose to walk in the Torah of Yahuah. No one choose to love their Creator.

The actions of Adam and Eve, crossed the boundary (or genetic "fence") set up by the creator that each thing should reproduce after its own kind. Eve (of one species) created an offspring from a different species (man). The genetic transmutation that resulted was named "Cain." His twin brother was named, Able.

Flee from sexual immorality. All other sins a man commits are outside his body, but he who sins sexually sins against his own body. 1 Cor 6:18 (NIV)

This adulterous union changed the bodies of Adam and Eve, and caused an immediate separation from their creator. They lost their covering of light (energy) and were found to be naked. They now had a new likeness. If Adam and Eve had become what Yhwh intended them to be, and ate of the tree of life, they would of had children in the likeness of Yhwh, which is how they themselves looked. Instead, after they had sinned, Adam;

.........begat a son in his own likeness, after his image; and called his name Seth: Gen 5:3 (KJV)

"His own likeness" meaning his changed (or fallen) image!

If only Adam had heeded the voice of Yahuah, he could have became a " part of the whole," a musical note in Yahuah’s symphony. 
Instead, they all decided to play a different song, and create something in their own image.  
Even the Hebrew word for Cain, "qanah," which means to erect and create; comes from the root word  "quwn," meaning to strike a musical note. 
Eve and Nachash created a "musical note" named Cain; but it was not in harmony with Yahuah's original plan.

Learn a lesson from the Olive Tree and the Fig Tree.

Once Adam and Eve had sinned, they severed their intimate relationship with Yahuah, and their covering of light/energy left them;

"...they sewed fig leaves together and made themselves coverings." Gen  3:7 (NKJ)

There is an important distinction to be made here between the Olive tree and the fig tree.
The olive tree is compared to the nation of Israel,  the chosen people, and the holy seed. 

The cherubim covering the Ark of the Covenant were also made of olive wood.

Olive Oil provided light for each family.

Olive oil is used for anointing, and healing.

In ancient times they made soap out of olive oil.

 

The Olive tree is an evergreen, symbolizing eternal life.

Its feather shaped leaves have no lobes and grow opposite one another; giving it the appearance that the entire tree is covered in sets of two leaves.

Look carefully at the leaves of the Olive tree,
They grow opposite one another, horizontally on the vertical branch. 

The leaves are a picture of the base pairs that attach to each strand of DNA.

The Olive Tree is a picture of DNA.

In stark contrast;

The fig tree is deciduous, its leaves are seasonal and not evergreen (symbolizing mortal life).

It has alternate leaves (instead of opposite ones).

Its deeply lobed leaves are in the shape of the human hand.

 


The olive tree is a picture of what Adam and Eve were made to be, a separate species with a unique genome. They were the two leaves opposite each other, complimenting each other. They were each others counterpart.  In fact, the Hebrew word describing Eve and used for "help meet" [neged] means "part opposite" or "counterpart."

They were to be like the torah, two individual tablets which were actually, One.

Mankind is like the fig tree, whose leaves are in the shape of a human hand. When Adam and Eve sinned, and their covering of light departed from them, they found themselves naked and looking in appearance like mankind. This is what is meant by they "covered themselves in fig leaves." and tried to hide from Yahuah among the fig trees [men] of the garden. 
Adam and Eve did not become eternal like the evergreen olive tree. Instead, their bodies became mortal like the deciduous fig tree. When Yahuah came looking for Adam in the Garden, He found that Adam and Eve had not eaten from the tree of life and produced fruit. Instead he found them covered in fig leaves with no fruit at all. A picture of this is found in Matthew's (MatatiYahu) gospel;

And when he (Yahuahshua) saw a fig tree in the way, he came to it, and found nothing thereon, but leaves only, and said unto it, Let no fruit grow on thee henceforward for ever. And presently the fig tree withered away. Matt 21:19 (KJV)

This is the fate that Adam and Eve suffered. They had a chance to eat from the tree of life and become eternal, and produce children (fruit) that were eternal. Instead, they became mortal, "deciduous," like the fig tree and withered away. 

The end of Adam’s rule.

All of this came about because Adam handed over his power and authority to Satan (the chief adversary). He allowed Satan to usurp his rule.

The man Nachash, was either possessed by Satan, just as Satan entered into Judas in Luke 22:3 (an actual bodily possession); or Satan used his wisdom and beauty to influence the man called Nachash into participating in his plan. 
When Eve said, "the serpent beguiled me" she was saying in fact,  that she was sexually seduced. The word "to beguile" [nasha' in Hebrew] means
to lead astray, to delude, or (morally) to seduce. The noun "nachash"  also means "to learn by experience." The purpose behind a spell or enchantment is to induce or manipulate someone into taking a certain action, to learn by experience.
In the case of Genesis chapter 2, the real meaning behind the phrase, the "tree of the knowledge of good and evil,"  is to know evil, through a personal experience. A person can know and understand the concept of evil; but that doesn't compare to the first hand knowledge of having done it; to have learned it by experience.
After Nachash had seduced Eve, and as a consequence for his sin, he was cursed by Yhwh:

So Yhwh said to the serpent: "Because you have done this, you are cursed more than all cattle, and more than every beast of the field; on your belly you shall go, and you shall eat dust all the days of your life. Gen 3:14 (NKJ)

This curse is pronounced on Nachash, but it has befallen all of mankind due to sin.
The words, "You shall go," from the phrase "on your belly you shall go" is translated from the Hebrew word "yalak" which means "to walk" - as a man walks - on two legs! There is an important distinction to make when interpreting this phrase. It is one that has been erroneously translated for years.
Compare this word "yalak" [to walk] to the Hebrew word "ramas" which means "to glide swiftly or crawl."] It is apparent that "ramas" describes the movement of a snake, and not "yalak." If Nachash was a snake, or cursed to become a snake, "ramas" would have been the correct word to use instead of "yalak." A snake does not walk on two legs. Instead "yalak" is used to make a point which clarifies the meaning of the entire phrase, "on your belly you shall go." It meant that your existence in this new reality, will be based on maintaining a full stomach. No longer will everything you need be provided without labor or cost. The former economy is gone.
 You will now work the ground. 
Nachash is not a snake, he is a human man walking on two legs with an empty stomach. 
This is the heart of the curse; the consequence for sin is death, and the cost of staying alive is to trade our life minutes in pursuit of our necessities. How ironic. The very thing we are trying to preserve, our biological life, we expend in support of its maintenance. A sad commentary about what we've become. All of the accomplishments that man takes pride in; his civilization, science and technology, are all made possible by a full stomach. 

Obviously Nachash was able to influence Eve by his words, but still I wonder, what  was the exact meaning behind the phrase he used, to finally lure Eve into action?

...in the day you eat of it your eyes will be opened and you will be like "the Mighty Ones." [Ulheem] 

The intent is obvious,  that Eve could elevate her position from what she is, to the status of a "god." But the nature of this temptation is what puzzles me. Eve was already like Yahuah, THE Mighty One. In fact, she and Adam were the expressed image of the oneness of the Creator. They were not like mankind, who was made in His image and likeness alone. They were more like Yahuah than any male or female man; or any angelic being; even the guardian cherub (Satan) who is tempting her (through Nachash)!.  So how was this temptation - tempting?  Is Nachash actually telling Eve that together with him, she could create an entirely new creature, and in doing so, she would become like Yahuah, as the originator of a new species? This, as opposed to having children through Adam, which would be in the image of Yahuah; just as she and Adam were in his image? Or, was this even an issue, since having children by Adam wasn't happening? Which adds to my suspicion that Adam rejected Eve's status as he wife. Even when Adam is asked by Yahuah to give an account of his sin, Adam replies; 

"The woman whom You gave to be with me, she gave me of the tree, and I ate." Gen 3:12 (NKJ)

The woman whom you gave to be with me???  What were they, companions? Or, room mates?
Those are hardly the words a loving husband would use to describe his wife. Especially when you take into account that Adam is saying this to the One who made her expressly for him. In my opinion, this is a dejectedly spiteful remark. 


The actions of Eve and Nachash corrupted the natural order of creation, namely that every created thing was made to reproduce according to its own kind. Their relationship resulted in the making of two separate seed lines; one that is of the serpent, and another of Adam.

And Yahuah said unto the serpent,.....I will put enmity (hostility, hatred) between thee and the woman, and between thy seed (posterity) and her seed (posterity); it (she, the woman) shall bruise (crush) thy head, and thou shalt bruise (strike or restrain) his heel. Gen 3:14-15 (KJV)

This was one of the consequences for commingling the two species. The DNA of Nachash has become a snare, an entanglement that restrains (by grasping onto) the heel of the foot, of Eve's posterity. 
In order to preserve Eve's seed line, a Hebrew person was commanded not to marry a non-Hebrew. There were other commandments that the Hebrews were to observe that expressed this same idea; that the integrity of creation was to be protected and preserved. 

"'Keep my decrees. "'Do not mate different kinds of animals. "'Do not plant your field with two kinds of seed. "'Do not wear clothing woven of two kinds of material." Lev 19:19

"Do not plant two kinds of seed in your vineyard; if you do, not only the crops you plant but also the fruit of the vineyard will be defiled. Do not plow with an ox and a donkey yoked together. Do not wear clothes of wool and linen woven together." Deut 22:9-11 (NIV)

The point being made here is simple. There are to be no genetic trans-mutations; or one type of creature mating with a different kind. Although the word "trans-mutation" is now considered somewhat archaic, it's definition remains the same. It is the change of one form into another. 
The mule is the most common hybrid known in the animal kingdom which results from a transmutation. By mating a female donkey and a horse, a hybrid offspring (the mule) is produced. A mule (like all hybrids) are sterile and cannot reproduce. Although the donkey and the horse belong to the same family classification of Equidae, they are two different species. 
In the same way, Adam and Eve, along with mankind (male and female persons) were two separate species. When the two commingled, they produced a hybrid offspring that was mortal. Just as the mule can "bear no fruit" (or produce a lineage) their adulterous relationships could not produce an offspring with immortal life.

The prophet Ezekiel uses an analogy to compare the two Houses of Israel (Ephraim and Judah), with two daughters by the name of Oholah,and Oholibah who have gone whoring after idols.
Ezekiel uses donkeys and horses as a simile to exemplify the sinful relationship between the daughters of Israel and the Babylonians; as well as the spiritual adultery they committed by worshipping the gods of Egypt. By extension, he also gives us a picture of the first illicit union between two different species that occurred in the garden of Eden; that of Nachash and Eve.

"And the Babylonians came to her into the bed of love, and they defiled her with their whoredom, and she was polluted with them, and her mind was alienated from them. So she discovered her whoredoms, and discovered her nakedness: then my mind was alienated from her, like as my mind was alienated from her sister. Yet she multiplied her whoredoms, in calling to remembrance the days of her youth, wherein she had played the harlot in the land of Egypt. For she doted upon their paramours [lovers], whose flesh is as the flesh of asses, (Donkeys) and whose issue (sperm) is like the issue of horses." Ezek 23:17-20

In this example, the daughters were polluted (contaminated) through the illicit relationship they had with their adulterous lovers. By comparing "her" lovers with the flesh of donkeys and the sperm of horses, he is describing the creation of a mule. 

The donkey is used as a simile for man. It is the only animal in the scriptures to be given the power of speech, and talk like a man. It is also the only animal who must be redeemed with a lamb (a metaphor for the Messiah) or suffer death:

".......set apart to Yhwh all that open the womb, that is, every firstborn that comes from an animal which you have; the males shall be Yhwh's. "But every firstborn of a donkey you shall redeem with a lamb; and if you will not redeem it, then you shall break its neck. Exod 13:12-13 (NKJ)

Why single out the donkey as the only animal whose first born is unacceptable for dedication to Yahuah? Because the sacrifice of a donkey (a mortal man) could not reverse Adam's curse. Only a sinless immortal body that has died, could be called back from the grave.

"...and He said to them, "Go into the village opposite you; and as soon as you have entered it you will find a colt (the offspring of a donkey) tied, on which no one has sat. Loose it and bring it." Mark 11:2 (NKJ)

This colt was an "unbroken" animal on which no man had ever ridden. Was Yahuahshua a bronco rider? Instead, I think when he sat upon this colt it was immediately tamed. In the same way that a man's animal nature can be tamed by the Holy Spirit of Yahuah.


Mankind had a certain genome, and the same was true for Adam and Eve. When Eve produced an offspring with a human man and then with Adam; there became two lines of descendants, Cain and Abel. They each had a different physiology. 
Earlier, when I referred  to Adam's blood as "plasma" I did this primarily to differentiate his blood from mankind's blood. I really have no way of knowing for certain what the exact properties of his blood was, but I have a theory. Since Adam had a covering of Light (energy) he did not need many (or most) of the components that human blood has today. If you look at the molecular structure of human blood (diagram below) you'll see that all humans contain enzymes which catalyze the synthesis of the O antigen. This is the common denominator among all men, and was most likely the blood group of mankind. On the other hand, humans with A-type blood contain an additional enzyme (called A-type enzyme) which adds N-Acetylgalactosamine to the O antigen.  Humans with B-type blood contain another enzyme (called B-type enzyme) which adds Galactose to the O antigen.  Humans with AB-type blood contain both A-type and B-type enzymes while humans with O-type blood lack both types of enzymes.


          

http://www.web-books.com/MoBio/Free/Ch1B5.htm


If mankind (male and female human beings) had "O" type blood, then Adam and Eve most likely had "AB" type blood. You can see that A and B separately, or AB together attach themselves to "O" type blood molecules. This is a modification. This is what occurred when the two separate bloodlines were mixed. Since 55% of human blood is made up of plasma, and 92% of that plasma is water; I see at play here the two different types of water mentioned earlier when describing the firmament made on the second day of creation. Adam, being made from the dust of the ground and the spirit of Yahuah, had a different type of blood (plasma) made from "spiritual water." And though Adam and Eve should have had children that were flesh, bone, and water (AB plasma) they mingled their blood with the flesh, bone, and "O" type blood of man. They combined both genomes of the two different species.

Which gives meaning to this scripture:

Inasmuch then as the children have partaken of flesh and blood, He Himself likewise shared in the same, that through death He might destroy him who had the power of death, that is, the devil, Heb 2:14 (NKJ)

As I wrote earlier, the phrase, "Inasmuch then" means "because of the fact that." So, because of the fact that the children of Yahuah who were supposed to come down through the lineage of Adam and Eve; had become mingled with flesh and blood man (not according to the original plan of Yahuah); Yahuahshua (Messiah) also had to share in the same flesh and blood in order to reverse the curse of sin and death.

This is what is written about in Ephesians:

But now in Messiah Yahuahshua you who once were far off have been brought near by the blood of Messiah. For He Himself is our peace, who has made both one, and has broken down the middle wall of separation, having abolished in His flesh the enmity that is, the law of commandments contained in ordinances, so as to create in Himself one new man from the two, thus making peace, and that He might reconcile them both to Yahuah in one body through the cross, thereby putting to death the enmity [this is the enmity of Genesis 3:15]. Eph 2:13-16 (NKJ)

By His birth, Yahuahshua created (in his own body) "one new man" from the "two" biological systems formally known as Adam (Eve) and mankind. The science behind how Yahuah achieved this miracle has only been made known in recent years. I'l cover this later on.

As a side not,  the blood on the Shroud of Turin tested positive for AB blood. This blood type accounts for less than 6% of the world's population and is concentrated mostly around Palestine (Israel) and former Babylon (Iraq). The Vatican has rejected the idea that the blood on the Shroud belongs to Yahuahshua, because scientists have cloned a small percentage of the blood from the shroud and it contains a "Y" sex chromosome. The Roman Catholic Doctrine of the Virgin Birth means the church cannot accept these results. It would mean that Yahuahshua's conception occurred in the natural way, and that Joseph was his natural father.
Since most Christian denominations believe in the Virgin Birth or conception, the Hebrew bloodline or pedigree from Eve to the Messiah is not considered important. However, that is not the official position of the scriptures. The Virgin Birth Doctrine must either be substantiated by the scriptures or discounted.

The Psalmist wrote about Yahuahshua saying:

"Then said I, Lo, I (Messiah) come: in the volume of the book it is written of me,..." Ps 40:7 (KJV)

In other words, we should be able to find everything we need to know about a virgin conception in the Old Testament, since the Old Testament (Tenach) testifies about the Messiah. This is the same place the Apostles of Yahuahshua Messiah looked for truth;

For we have not followed cunningly devised fables, when we made known unto you the power and coming of our savior Yahuahshua, but were eyewitnesses of his majesty. 2 Pet 1:16 (KJV)

In my opinion, the acceptance of the Virgin Birth Doctrine stemmed from a lack of understanding. The Church Fathers of the 2nd, 3rd, and 4rth centuries did not perceive the notion that there are three different types of bodies written of in the scriptures; the mortal, immortal, and eternal body. Without this understanding, how does someone reconcile the scriptures which say that the Messiah was fully man and fully Divine? Does that mean he was 50% man and 50 % Divine; or 100% man and 100% divine? If he was 100% divine, could he have been tempted by evil?

"...for Yahuah cannot be tempted with evil, neither tempteth he any man:" James 1:13 (KJV)

Yet the scriptures say that Yahuahshua was;

"led up of the Spirit into the wilderness to be tempted of the devil." Matt 4:1 (KJV)

"For in that He Himself has suffered, being tempted, He is able to aid those who are tempted." Heb 2:18 (NKJ)

We know for sure that he could not have been born with a mortal body, that body has been cursed because of sin, and he never committed sin. He was not born with an eternal body because this body derives its power from the self existent nature of the Creator. It cannot be diminished in form or suffer death. It does not take a degree in genetics to see that Adam possessed an immortal body, or one that did not have to die. Yahuahshua possessed the same type of body. We who live in the modern world should be able to understand that a re-alignment of the exact same genetic sequence that existed in Adam's body would produce an immortal person, just as Adam was immortal prior to when he sinned.

Even so, without taking human biology into consideration, the Old testament should support the Virgin Birth Doctrine if it is scriptural.

These are the New Testament verses, found in Matthew and Luke's gospels; which take certain verses from the Isaiah 7, and use them to define the doctrine of the virgin birth of Yahuahshua.

But while he (Joseph) thought on these things, behold, the angel of the Lord appeared unto him in a dream, saying, Joseph, thou son of David, fear not to take unto thee Mary thy wife: for that which is conceived in her is of the Holy Ghost.
And she shall bring forth a son, and thou shalt call his name JESUS: for he shall save his people from their sins.
Now all this was done, that it might be fulfilled which was spoken of the Lord by the prophet, saying,
Behold, a virgin shall be with child, and shall bring forth a son, and they shall call his name Emmanuel, which being interpreted is, God with us. Matt 1:20-23 (KJV)

And in the sixth month the angel Gabriel was sent from God unto a city of Galilee, named Nazareth, To a virgin espoused to a man whose name was Joseph, of the house of David; and the virgin's name was Mary. And the angel came in unto her, and said, Hail, thou that art highly favoured, the Lord is with thee: blessed art thou among women. And when she saw him, she was troubled at his saying, and cast in her mind what manner of salutation this should be.
And the angel said unto her, Fear not, Mary: for thou hast found favour with God.
And, behold, thou shalt conceive in thy womb, and bring forth a son, and shalt call his name JESUS. Luke 1:26-31 (KJV)


The first thing I notice about the two accounts is that Joseph and Mary are both told to give the Messiah the name "Jesus" which is different from the name given to the child in Isaiah 7, which is Emmanuel.  Although theologians attempt to explain this discrepancy by saying that "Emmanuel" is more or less a "title" meaning "God with US," and "Jesus" was his proper name. 
This is a false statement because Emmanuel is a proper name (and not a noun).

The Hebrew name `Immanuw'el, (pronounced, im-maw-noo-ale') [#6005] means "with us is UL (God)." The name "Jesus" has no place in this name, in fact, it has no root or foundation in Hebrew.

Look at Matthew 1:23a in the Greek text translated into English.
The Greek words appear in the heading, with Strong's reference numbers beside each word.

              Behold a maiden be with child

 idou (#2400) parthenos (#3933)  echo (#2192) en (#1722)   gaster (#1064)
Behold (Lo!) a maiden;
(an unmarried daughter)
be
with child

             and, bring forth a son and, to call

kai (#2532)  tikto (#5088) huios (#5207) kai (#2532)  kaleo (#2564) 
and, bring forth a "son"  and,  to "call"

            him a name called, God with us.

autos (#846) onoma (#3686) Emmanouel (#1694)     
him
a "name"
called
of Hebrew origin 
 God with us
   

The Greek word "parthenos" is translated as; "a maiden or unmarried woman." This agrees with the Hebrew thought being conveyed in the original text from Isaiah chapter 7, where this verse is borrowed from.  Matthew 1:23 is said to be a fulfillment of Isaiah's prophecy (shown below).

Therefore Yhwh himself shall give you a sign; Behold, a virgin shall conceive, and bear a son, and shall call his name Immanuel.
Isa 7:14 (KJV)


But In order to discover the truth, the context in which the prophecy was made needs to be examined in its historical context.

Rezin the King of Syria, and Pekah the King of Israel (the Northern Kingdom) entered into an alliance against Judah. Ahaz, a wicked King who practiced idolatry, ruled over Judah. 
At first, Rezin and Pekah were successful in attacking Judah. It was in this setting that King Ahaz receives this prophecy:

Now it came to pass in the days of Ahaz the son of Jotham, the son of Uzziah, king of Judah, that Rezin king of Syria and Pekah the son of Remaliah, king of Israel, went up to Jerusalem to make war against it, but could not prevail against it. And it was told to the house of David, saying, "Syria's forces are deployed in Ephraim." So his heart and the heart of his people were moved as the trees of the woods are moved with the wind. Then Yahuah said to Isaiah, "Go out now to meet Ahaz, you and Shear-Jashub your son, at the end of the aqueduct from the upper pool, on the highway to the Fuller's Field, "and say to him: 'Take heed, and be quiet; do not fear or be fainthearted for these two stubs of smoking firebrands, for the fierce anger of Rezin and Syria, and the son of Remaliah. 'Because Syria, Ephraim, and the son of Remaliah have plotted evil against you, saying, "Let us go up against Judah and trouble it, and let us make a gap in its wall for ourselves, and set a king over them, the son of Tabel"-- 'thus says Yahuah Ul: "It shall not stand, nor shall it come to pass.
For the head of Syria is Damascus, and the head of Damascus is Rezin. Within sixty-five years Ephraim will be broken, so that it will not be a people. The head of Ephraim is Samaria, and the head of Samaria is Remaliah's son. If you will not believe, surely you shall not be established."' 
Moreover Yahuah spoke again to Ahaz, saying, "Ask a sign for yourself from Yahuah your Ul; ask it either in the depth or in the height above." But Ahaz said, "I will not ask, nor will I test Yahuah!"
Then he said, "Hear now, O house of David! Is it a small thing for you to weary men, but will you weary my Mighty One also?
"Therefore Yahuah Himself will give you a sign: Behold, the virgin shall conceive and bear a Son, and shall call His name Immanuel.
"Curds and honey He shall eat, that He may know to refuse the evil and choose the good.
"For before the Child shall know to refuse the evil and choose the good, the land that you dread will be forsaken by both her kings. Isa 7:1-16 (NKJ)

The word translated above as "virgin" should actually be translated as a  "maiden."  Taken in the context shown above, this prophecy is not messianic in nature, but rather one that was intended for King Ahaz in his day and time. 

At the time this prophecy was given, a maiden had conceived who will name her son, Emmanuel; and by the time he is old enough to chose between right and wrong, the land of  Syria and Israel (the Northern Kingdom) will be laid waste. This prophecy was fulfilled  2-3 years later when Hosea (the son of Elah) slew Pekah (2Kings 15:30); and the King of Assyria slew Rezin (2 Kings 16:9).
These are the facts.

Look at the original Hebrew prophecy made by Isaiah.

Behold, a virgin (almah) shall conceive, and bear a son, and shall call his name Immanuel.
Isa 7:14 (KJV)


The Hebrew word  "almah" is translated into English as "virgin" (shown below).

[Hebrew is read from right to left.]

ben (#1121)  yalad (#3205)   hareh (#2030) `almah (#5959) hinneh (#2009)
a son  to bear young; pregnant;
with child
damsel, maid,
virgin.
behold, lo

The word 'almah is usually translated as a damsel (unmarried woman) or maid. But here the translators choose, "virgin." They did this deliberately and after the fact, to connect this verse to the one in Matthew.

Christian Bible scholar Dr. Wiiliam Gesenius writes that "'almah" denotes a girl of marriageable age.  He notes that:

"the notion of unspotted virginity is not that which this word conveys, for which the proper word is
bethuwlah (beth-oo-law' #1330)." 

Bethuwlah means a virgin pure and unspotted so called as being separated and secluded from intercourse with men.*

*Gesenius'Hebrew-Chaldee Lexicon of the Old Testament, pages 149 & 634.


Because of his position on this translation, Gesenius, a renowned scholar of the highest standard, fell out of favor with Christian theologians.
A note made by the  Editor of a later reprinting of Gesenius' book (after his death) appears in brackets on page 634, and attempts to qualify Gesenius' statement by saying,


"The object in view in seeking to undermine the opinion which would assign the significance of virgin to this word, is clearly to raise a discrepancy between Isa 7:14 and Matt 1:23; nothing which has been stated does, however, really give us any ground for assigning another meaning."

That is a mouth full! It's one thing to try and politely discredit some ones scholarly findings with facts, but quite another to be openly antagonistic, to the point where your prejudice is exposed.
I broke down into segments the Editor's statement, to make sure I understood his position regarding the two different Hebrew words, "almah," and "bethuwlah." I understand Gesenius' approach to his work, which is methodical and fact based, and not dependent upon his feelings or emotions. The editor's view seems to be the opposite of this.

"The object in view [the discrepency between the definitions of "almah" and "bethuwlah."] 

in seeking to undermine the opinion
[the opinion being referred to here is the collective and accepted theological opinion, which is allegedly being "undermined" by Gesenius. Notice the word "undermine" is used deliberately to put Gesenius' translation on the defensive. The collective opinion is not going to allow itself to be challenged, argued with, or tested based on its own merit. In fact, just the act of calling it into question, regardless of the reason, is forbidden.]

which would assign the significance of virgin to this word,
[ that significance was already apparent in the Hebrew language itself. "Bethuwlah" is used exclusively to describe "a virgin," and not "almah." 

is clearly to raise a discrepancy between Isa 7:14 and Matt 1:23; [Such a discrepancy already exists based solely on the historical context of Isaiah chapter 7.]

nothing which has been stated does, however, really give us any ground for assigning another meaning." 


This is nothing less than a poor attempt
to make an apology for a dead man that never made such an apology while he was alive. The Editor's comments also reveal the sentiments of most Christian theologians and denominations in general. Namely, we have a long standing tradition called the Virgin Birth doctrine that will not be questioned. 

But for those who like to question the status quo in search of the truth, let us continue in this review of the circumstances surrounding the prophecy of Isaiah 7 and 8.

Moreover YHWH said to me, "Take a large scroll, and write on it with a man's pen, Maher-Shalal-Hash-Baz. Isaiah 8:1

The name "Maher Shalal Chash Baz; is the symbolical title given to Isaiah's son. It means "the enemy is swift to the prey (the spoils of war)." It is part of the prophecy regarding the destruction of the Kings of Syria and Israel by the King of Assyria.

And I (Isaiah) went unto the prophetess, and she conceived and bore a son. Then Yahuah said to me, "Call his name Maher-Shalal-Hash-Baz; Isiah 8:3

The identity of the prophetess is no mystery, it is Isaiah's wife. This has always been common knowledge among Christian theologians, as cited by Matthew Henry in his commentary;

"The wife of a prophet is called a prophetess (Henry) .


When Isaiah "went unto the prophetess," he did so to have sexual relations with her (his wife). She conceived and give birth to the prophesied son, his title was "Maher-Shalal-Hash-Baz," but his proper name was; 

`Immanuw'el, the name of Isaiah's son. 

It was never prophesied that Immanuel's birth would come through a virgin.

Why did the editors of the New Testament extract this unrelated prophecy from Isaiah, and insert it in Matthew 1:23? 
Why is t
here is no mention of a virgin birth in any of the Epistles written by the Apostles. Even though most Bible scholars agree that the Epistles predate the writings of the Gospels. 
Why is there nothing written about the Virgin Birth in the Book of Acts?  Why are the Gospels of Mark and John silent concerning a virgin birth? It only stands to reason that such a spectacular event should have been mentioned by all of the apostles.  
If the Messiah was to be conceived through a virgin conception, there would be no need for Yahuah to preserve the integrity of the seed line from Eve to Christ. But there was a need, and he did preserve it. 
After Yahuah's promise to bring forth a redeemer from Eve, the promise continues through Abraham, then Isaac, Jacob (Israel), Judah, and ultimately through the line of King David.
A key factor in Messianic prophecy that is usually overlooked are the promises made to the House of Joseph, Jacob's son. Although the House of David plays a key role in Messianic prophecy, in order for all Messianic prophecies to be harmonious, the House of Joseph must be included. 

I'll begin with the House of David,  which leads to the contradictory records of Yahuahshua's lineage that appear in Luke and Matthew.

Yahuah hath sworn in truth unto David; he will not turn from it; Of the fruit of thy body will I set upon thy throne. Psalm 132:11

This is self explanatory, but in the next verse Yahuah further explains that this is a conditional blessing, when considering David's children; 

If thy children will keep my covenant and my testimony that I shall teach them, their children shall also sit upon thy throne for evermore. Psalm 132:12

Solomon does not live up to the agreement Yahuah made with King David, and loses the kingdom:

But king Solomon loved many strange women, together with the daughter of Pharaoh, women of the Moabites, Ammonites, Edomites, Zidonians, and Hittites;
.....Solomon clave unto these in love. .. For it came to pass, when Solomon was old, that his wives turned away his heart after other gods: ... And Solomon did evil in the sight of Yahuah, ... And Yahuah was angry with Solomon, because his heart was turned from Yahuah the Mighty One of Israel, ... Wherefore Yahuah said unto Solomon, Forasmuch as this is done of thee, and thou hast not kept my covenant and my statutes, which I have commanded thee, I will surely rend the kingdom from thee, and will give it to thy servant. Notwithstanding in thy days I will not do it for David thy father's sake: but I will rend it out of the hand of thy son. Howbeit I will not rend away all the kingdom; but will give one tribe to thy son for David my servant's sake, and for Jerusalem's sake which I have chosen. IKing 11:1-13 (KJV)

Yahuah gave the Kingdom to Solomon's servant, Jeroboam.

However, theologians still teach that the Messiah's lineage must come through David's son, Solomon. Many cite the prophecy given by Nathan the Prophet in 2 Samuel (shown below) as being directed toward Solomon. My question is, seeing in the scriptures that Solomon lost the kingdom, how can this saying be written about Solomon?

And it shall come to pass (David), when thy days be expired that thou must go to be with thy fathers, that I will raise up thy seed after thee, which shall be of thy sons (he doesn't say which one); and I will establish his kingdom. He shall build me an house, and I will establish his throne for ever. I will be his father, and he shall be my son: and I will not take my mercy away from him, as I took it from him that was before thee: But I will settle him in mine house and in my kingdom for ever: and his throne shall be established for evermore. According to all these words, and according to all this vision, so did Nathan speak unto David. 2 Sam 7:12-15 (KJV)

This is actually a prophecy written about the Messiah! He is the Son who will proceed forth from the lineage of David, the one who the Father will refer to as "My Son." The Son who built Yahuah a house by resurrecting His immortal body, and making into in an eternal house.

For in Yahuahshua all the fullness of (the Deity) Yahuah lives in bodily form, Col 2:9 (NIV)

There exists a point of contention for all of those who require the Messiah to come from Solomon's line. That point of contention is the curse of Jeconiah. At the time of the Babylonian captivity (586 B.C.), it is written of King Jeconiah, the King of Judah, that he and his lineage were cursed by Yahuah;

Thus saith YHWH, Write ye this man (Jeconiah) childless, a man that shall not prosper in his days: for no man of his seed shall prosper, sitting upon the throne of David, and ruling any more in Judah. Jer 22:30 (KJV)

Since this curse effectively cuts off the lineage of David through Solomon; then whose line will the Messiah come through?  Luke records His genealogy as coming by way of David's son, Nathan. Mary, the mother of Yahuahshua; had a cousin named Elizabeth, who was of the House of Levi; being a daughter of Aaron (Luke 1:5). Since Mary and Elizabeth were cousins, that means that Elizabeth's mother and Mary's mother were most likely sisters. This would make Mary, the mother of Yahuahshua, also of the House of Levi. Since almost all of the names listed in Luke's genealogy can not be linked elsewhere in the Old Testament; we can only assume that one of Mary's ancestor's (perhaps even her Father) was of the line of Nathan. Which would mean that Mary, the mother of Yahuahshua, was of the House of David, and also of the House of Levi. This exact pedigree is alluded to in Zechariah's messianic prophecy about the crucified Messiah; 

"And I will pour on the house of David and on the inhabitants of Jerusalem the Spirit of grace and supplication; then they will look on Me whom they have pierced; they will mourn for Him as one mourns for his only son, and grieve for Him as one grieves for a firstborn. "In that day there shall be a great mourning in Jerusalem, like the mourning at Hadad Rimmon in the plain of Megiddo.
"And the land shall mourn, every family by itself: the family of the house of David by itself, and their wives by themselves; the family of the house of Nathan by itself, and their wives by themselves;
"the family of the house of Levi by itself, and their wives by themselves; the family of Shimei (Shim'e-ites) by itself, and their wives by themselves;
"all the families that remain, every family by itself, and their wives by themselves. Zech 12:10-14 (NKJ)


It's interesting that Zechariah would single out the Families of Nathan, Levi, and the clan of Shimei in a special way; when prophesying about the Messiah. With no mention of Solomon's line who was barred from ever sitting upon the throne of Judah - forever. This means that even if Yahuahshua had a step Father, as many presume, that step Father could not inherit the throne of David, and then pass it on to his adopted son. According to Hebrew law, an adopted son could not inherit the throne. That right belongs only to a natural born son. Even so, theologians will use the genealogy of Matthew Chapter One as a way to demonstrate Yahuahshua's legal right to the throne of David, by adoption. In order to side step Jeconiah's curse, which would befall a natural born son, they say the Messiah would have to come by way of a "miraculous" or heavenly conception.  This is a complete and total fabrication. The Gospel of Luke dispels this contrivance by showing the Messiah's genealogy (on his Mother's side) as coming through Nathan and not Solomon. 
I believe Matthew Chapter One was inserted much later, possibly during the 3rd or 4rth Century, to support the Virgin Birth Doctrine. My reason for this allegation is this; many of the books of the Bible are written as Historical narratives. These narratives typically begin with the name of the main character, and the time frame in which the story occurred, dated by the reign of a notable ruler or some other prominent historical figure. This occurs in the Old Testament, and it occurs in Matthew's gospel beginning in chapter two.

These are some examples:

Ruth 1:1-2

Now it came to pass in the days when the judges ruled, that there was a famine in the land. And a certain man of Bethlehemjudah went to sojourn in the country of Moab, he, and his wife, and his two sons. And the name of the man was Elimelech, and the name of his wife Naomi, ....... (KJV)

Ezra 1:1

1 Now in the first year of Cyrus king of Persia, that the word of Yahuah by the mouth of Jeremiah might be fulfilled, ......... (KJV)

Esth 1:1-3

 Now it came to pass in the days of Ahasuerus, (this is Ahasuerus which reigned, from India even unto Ethiopia, ..... (The Story of Esther) (KJV)

Jer 1:1-2

The words of Jeremiah the son of Hilkiah, of the priests that were in Anathoth in the land of Benjamin: To whom the word of Yahuah came in the days of Josiah the son of Amon king of Judah, in the thirteenth year of his reign. (KJV)

[the pattern continues....]

Ezek 1:1-2

Now it came to pass in the thirtieth year, in the fourth month, in the fifth day of the month, as I was among the captives by the river of Chebar, that the heavens were opened, and I saw visions of Yahuah. In the fifth day of the month, which was the fifth year of king Jehoiachin's captivity, (KJV)

Dan 1:1

In the third year of the reign of Jehoiakim king of Judah came Nebuchadnezzar king of Babylon unto Jerusalem, and besieged it. (KJV)

Micah 1:1

1 The word of Yahuah that came to Micah the Morasthite in the days of Jotham, Ahaz, and Hezekiah, kings of Judah, which he saw concerning Samaria and Jerusalem. (KJV)

Zeph 1:1

The word of Yahuah which came unto Zephaniah the son of Cushi, the son of Gedaliah, the son of Amariah, the son of Hizkiah, in the days of Josiah the son of Amon, king of Judah. (KJV)

This same style of writing occurs in Matthew's gospel, beginning in Chapter TWO;

(And) when Yahuahshua was born in Bethlehem of Judaea in the days of Herod the king, ... Matt 2:1 (KJV)

Matthew chapter Two begins with the name of the main character, and the time period is notated by the reign of Herod the Great, a prominent ruler. This is the exact same form of the other Hebrew narratives shown above. I see this as evidence that Chapter TWO verse one is really the beginning of Matthew's gospel, and should be labeled Chapter ONE, verse one.
The false Chapter One, which allegedly lists the genealogy of Yahuahshua, exists solely to discredit any biological connection that Messiah might have thru David and Solomon, by linking Joseph his natural Father, to the curse of Jeconiah. If Joseph inherits the curse, then a natural born Messiah would be cursed also.


Upon close examination of the scriptures, it becomes apparent to me that the root of the problem lies in a cover up. This cover up centers around the most prominent Messianic prophecy of the entire scriptures, Joseph's 2nd dream of Gen 37:9. It is during this dream that Joseph sees the sun, moon, and the 11 stars bow down to him. Jacob and Joseph's brothers interpret this dream to mean that one day they will bow down to Joseph. Although Jacob is curious and ponders the matter, his brothers plot to get rid of him. Why didn't they just dismiss Joseph as self infatuated and laugh at his dream? The interesting thing is, they couldn't. They could sense his anointing, and they were jealous. 
Joseph's dream was partially fulfilled during the famine in Egypt, when most of his brothers bowed down before him as Pharaoh's Chief Administrator. It will be completely fulfilled one day, when all people will bow to Yahuah's Messiah, who came from the line of Joseph. 
It is important to note, this dream did not cancel out the promise Yahuah made regarding the Davidic line and it's role in bringing forth the Messiah. However, if the Messiah were to come only through the Davidic line, then why did Yahuah give this dream to Joseph instead of Judah ?

What makes me suspicious of a cover up is the pre-eminence given to the tribe of Judah, at the expense of the House of Joseph. This is not a prejudice that is dictated by the scriptures themselves, it is instead perpetrated by those who wrote and interpret them. Who was responsible for transcribing the scrolls and copying the books of the Old Testament? Scribes from either the tribe of Judah or the Tribe of Levi. Levi was the one tribe who did not receive an inheritance of land, and lived predominately among the tribe of Judah on their land. This preferential treatment given to Judah occurs in both the Old and New Testament. While this topic of study would be a book unto itself, I've listed a few examples below just to make a point.

Where was Christ born? There are two Bethlehems listed in the scriptures. One is listed in the Northern Kingdom in Galilee, called "Bethlehem Ephratha" (Joshua 19:10-16). The other Bethlehem is south of Jerusalem in Judea. This is the one referred to as "The City of David," as we see in Luke 2:11 

For unto you is born this day in the city of David a Saviour, which is Christ the Lord. Luke 2:11 (KJV)

Yet, during Yahuahshua's ministry, the people of Jerusalem knew that He was a Galilean, and this didn't fit with what they were told regarding Messianic prophecy; that the Messiah would be born in Bethlehem Judah;

Others said, This is the Christ. But some said, Shall Christ come out of Galilee?
Hath not the scripture said, That Christ cometh of the seed of David, and out of the town of Bethlehem, where David was? John 7:41-42 (KJV)

When members of the Sanhedrin brought Christ before Pilate to accuse him of stirring up trouble, they mentioned that he also taught in Galilee;

When Pilate heard of Galilee, he asked whether the man were a Galilaean.
And as soon as he knew that he belonged unto Herod's jurisdiction, he sent him to Herod, who himself also was at Jerusalem at that time. Luke 23:6-7 (KJV)

What do the scriptures mean by saying, " And as soon as he (Pilate) knew that he belonged unto Herod's jurisdiction, he sent him to Herod? This can only mean that after Pilate heard the Jews say he was a Galillean, he had someone check the official Roman census records for verification. Some time had elapsed between when Pilate first heard he was a Galilean, and then knew (for sure) that Yahuahshua was a Galilean. Since Herod was the Governor of Galilee, Pilate knew he belonged to Herod's jurisdiction. The "herod" being referred to here is Herod Antipas, the son of Herod the Great. It was Herod the Great who had the children of Bethlehem killed in an attempt to kill the newborn Messiah.

Then Herod, when he saw that he was mocked of the wise men, was exceeding wroth, and sent forth, and slew all the children that were in Bethlehem, and in all the coasts thereof, from two years old and under, according to the time which he had diligently inquired of the wise men. Matt 2:16 (KJV)

This Bethlehem mentioned here, is supposed to be the City of David, that is Bethlehem Judah. But notice the phrase "and in all of the coasts thereof..." 
Bethlehem Judah is about 7 miles south of Jerusalem, and 40 miles east of the Mediterranean coast. On the other hand, Bethlehem Ephratha in Galilee was 8 miles from the Mediterranean coast, and about 18 miles from the coast of the Sea of Galilee. Since Yahuahshua was from Galilee, to which Bethlehem did Herod the Great send his men to kill the children? The phrase, "Bethlehem and in all the coasts" is a dead giveaway. It obviously means it was Bethlehem Ephratha and the other coastal towns in Galilee. 
So why the deception? Why transfer the Messiah's birth from Galilee, the land which the House of Joseph inherited, to the Land of Judah? The answer is simple, for power and control. The power center of Israel was in Jerusalem, in the land of Judah.

I don't mention these things to cause despair over the scriptures, by questioning their validity. The truth cannot be broken. It is woven throughout the scriptures, in defiance of those who would attempt to change its meaning.
Yet, one must bear in mind that this book was assembled by men. The New Testament in particular, was created in the 4rth Century A.D. by the Roman Emperor Constantine who presided over the Council of Nicea. Only the writings that were approved by Constantine himself made it into the book. Even so, regardless of anyone's private agenda, those who believe in Yahuah by faith are guaranteed to be lead by the Holy Spirit into all truth. We must be willing  to tear down the strong holds and imaginations built by our adversary Satan. If we hold on to any of his deceptions, no matter how harmless they may appear to be, then we have affection for his lies. If we do this in light of the truth, we give Satan a certain pre-eminence in our lives. In effect, we bow down to him and worship him in place of our Father, the author of truth.
I will not bow down to Satan.

When I consider the discrepancies between the genealogy of Christ in  Matthew's and Luke's gospels; coupled with the understated prominece of the line of Joseph in Messianic prophecy, and the overstated role of the tribe of Judah; I come to one conclusion; the natural father of Yahuahshua, Mary's husband Joseph; must be a direct descendant of Jacob's son Joseph. Thereby fulfilling his ancestor (Joseph's) dream of being at the head of the Messianic lineage.
This was most likely common knowledge among the disciples; and part of the expectations of the people;

Philip findeth Nathanael, and saith unto him, We have found him, of whom Moses in the law, and the prophets, did write, Yahuahshua the Nazarene, the son of Joseph. John 1:45

Do you think Phillip was telling Nathaniel that they had found Yahuahshua, the son of Joseph the Carpenter; or Yahuahshua the son of Joseph, the son of Jacob (Israel)? 

Give ear, O Shepherd of Israel, thou that leadest Joseph like a flock; thou that dwellest between the cherubims, shine forth. Ps 80:1 (KJV)

Who is the shepherd of Israel, that leads the House of Joseph? None other than the Messiah himself.

Setting aside for now, the genealogy of Yahuahshua find in Matthew's gospel, Luke's gospel must be the record of Mary's parentage. As I mentioned earlier, since Mary's cousin Elizabeth was of the House of Levi, it's logical to assume that Mary was also a descendant of Levi. This would give Yahuahshua the right to wear the tunic of a Levitical Priest, a tunic woven without seams. This would be the same tunic the Roman soldiers cast lots for at the foot of the cross (or stake). They did not want to tear and divide among themselves, a garment that had no seams.

When you place Matthew's genealogy of Chapter One along side of Luke's genealogy of Chapter 3; several things are immediately apparent. Matthew charts his lineage thru Solomon with 27 generations before that of Messiah; and Luke charts his lineage thru Nathan (Solomon's brother) with 42 names (or generations) before Messiah.

The names marked with an asterisk* are not accounted for anywhere else in the Old Testament.

Matthew Gospel

David
Solomon
Roboam
Abia
Asa
Josaphat
Joram
Ozias
Joatham
Achaz
Ezekias
Manasses
Amon
Josias
Jechonias
Salathiel
Zorobabel
*Abiud
*Eliakim
*Azor
*Sadoc
*Achim
*Eliud
*Eleazar
*Matthan
*Jacob
Joseph
Christ
Luke's Gospel

David
Nathan
*Mattatha
*Menan
*Melea
*Eliakim
*Jonan
*Joseph
*Juda
*Simeon
*Levi
*Matthat
*Jorim
*Eliezer
*Jose
*Er
*Elmodam
*Cosam
*Addi
*Melchi
*Neri
Salathiel
Zorobabel
*Rhesa
*Joanna
*Juda
*Joseph
*Semei
*Mattathias
*Maath
*Nagge
*Esli
*Naum
*Amos
*Mattathias
*Joseph
*Janna
*Melchi
*Levi
*Matthat
*Heli
Joseph
Christ


How can two separate genealogies supposedly of the same person, one written by an apostle and the other by a disciple, be different?

Luke's genealogy must belong to Mary. If it does, the next question becomes, since Hebrew law only considers the Patriarchal side of a persons lineage, what purpose would it serve? The Hebrews used the Patriarchal method of recording heredity primarily to identify each tribe and clan; for the purpose of property rights and inheritance. However in this day and age, with our understanding of human physiology, we know there is more to heredity than just the male's biological contribution. The female ovum is a single cell organism with 23 chromosomes, just as the male sperm cell is a single cell organism with 23 chromosomes. When the two cells combine to form an embryo, the person being formed is made from the two parts.  It would be a lie to say that the genetic properties of the ovum had no part in determining a person's pedigree. Especially in the light of modern biology, when mitochondria DNA (the Mother's DNA)  is used to determine a person's ancestry. It is the Mother's DNA imprint that can trace back a person's lineage back to Eve.

It is most likely that Mary was of the House of David through Nathan on her Father's side, and of the tribe of Levi on her Mother's side. This is probably why most of the names in Luke's genealogy that are listed after Nathan, can't be found in the Old Testament. The list is probably the result of an oral tradition that was kept among Nathan's descendants. Especially since the established protocol among the rulers in Jerusalem was that the Messiah would come through Solomon (just as most Jews believe today). 
The fact that Levites married men from the tribe of Judah (Nathan's ancestor) was common place. To complete this pedigree, and bring all twelve tribes together;
Joseph, Yahuahshua's biological father, was of the House of Joseph.
Yahuahshua was not from the tribe of David alone, neither was he from the cursed line of Solomon. It was Yahuahshua himself who challenged the religious authorities of his day, and their interpretation of the Messiah's lineage, by asking them this question;

Then Yahuahshua answered and said, while He taught in the temple, "How is it that the scribes say that the Messiah is the Son of David?
"For David himself said by the Holy Spirit: 'Yahuah said to my Master, "Sit at My right hand, till I make Your enemies Your footstool." '
"Therefore David himself calls Him 'Master'; how is He then his Son?" And the common people heard Him gladly. Mark 12:35-37 (NKJ)

Here Yahuahshua reveals the one sided teaching of the scribes, who taught that Messiah would come from the House of Judah alone. Why does verse 37 say "And the common people heard him gladly?" Most likely because if David called the Messiah "Master" it would mean an end to the oppression and rule of the scribes and Pharisees; and their man made rules and regulations. Along with their false worship and redundant animal  sacrifices.
It seems to me that what the common people "heard gladly," was that the Messiah would rule over both the House of Judah and the House of Joseph. This would end the spiritual stranglehold the scribes and Pharisees had on everyone's life through their Mishpah and Babylonian Talmud.
I see this reunification as being accomplished in the body of Messiah, which joined the DNA of Ephraim (in Joseph) with the DNA of Judah and Levi in Mary.

Take another look at Luke's genealogy. There are several names that stand out and require further investigation. Two names in particular, Salathiel and Zorobabel, seem to have been inserted into Luke's genealogy, to create a link to the same two name in Matthews lineage. 
Salathiel and Zorobabel were of the lineage of Jeconiah (thru Solomon) which makes them ineligible to sit on the throne of David. Once again, if Joseph were descended from Salathiel and Zorobabel, he would be under Jeconiah's curse. Subsequently, if Yahuahshua was Joseph's natural born child, he would be under the curse also.
However, there are a number of inconsistencies in Salathiel's and Zorobabel's genealogy which lead me to believe the addition of their names in Luke's genealogy is a forgery.

This is the lineage of Jeconiah, the King of Judah, at the time that Judah was carried away into captivity by the Babylonians.

And the sons of Jeconiah; Assir, Salathiel his son, Malchiram also, and Pedaiah, and Shenazar, Jecamiah, Hoshama, and Nedabiah.

Clearly, Salathiel and Pedaiah were two brothers (among seven sons). 
Verses 18 and 19 go on to say;


And the sons of Pedaiah were, Zerubbabel, and Shimei: and the sons of Zerubbabel; Meshullam, and Hananiah, and Shelomith their sister:1 Chr 3:17-19 (KJV)

Here in 1 Chronicles; Zerubbabel is listed as Pediah's son, but in Matthew and Luke's genealogy both record Zorobabel ( a variation of the spelling Zerubbabel) as being the son of Salathiel;

And after they
(the Hebrews) were brought to Babylon, Jechonias (Jeconiah) begat Salathiel; and Salathiel begat Zorobabel; And Zorobabel begat Abiud; and Abiud begat Eliakim; and Eliakim begat Azor; Matt 1:12-13 (KJV)

Which was the son of Maath, which was the son of Mattathias, which was the son of Semei, which was the son of Joseph, which was the son of Juda, Which was the son of Joanna, which was the son of Rhesa, which was the son of Zorobabel, which was the son of Salathiel, which was the son of Neri, Luke 3:27 (KJV)

In 1 Chronicles; Zerubbabel has two sons named, Meshullam, and Hananiah. In Matthew 1; Zorobabel;s son is listed as Abiud (no mention of Meshullam and Hananiah). In Luke 3; Zorobabel has a son named Rhesa, with no mention of Abiud, Meshullam, or Hananiah.
Some (if not most) Bible scholars suggest that Salathiel must have died without having a son. So, under Mosaic law (Deuteronomy 25:5-6) Pediah could have married Salathiel's widow. If he did, her first born son would be the son of Salathiel (for his name's sake), and the son of Pediah, for the sake of inheritance and property rights.
However, if you look at the names in Luke's genealogy (shown on the chart) Salathiel's father's name is listed as Neri, and not the Jeconiah of 1 Chronicles 3:17.
Based on a preponderance of the evidence, this leads me to believe two things;

1.  Zerubbabel - Zorobabel are, at the very least,  two different people.


2.  The explanation put forth by Bible scholars regarding Salathiel's probable death, and Pediah's subsequent marriage to his widow, cannot be substantiated. 

This is what lead me to believe that Salathiel and Zorobabel were inserted into Luke's genealogy to link Joseph to the curse of Jeconiah. Which is the same reason why I think Matthew Chapter One is a forgery. It contains a genealogy that also comes through Jeconaih.

The next set of names, that stand out in Luke's lineage of the Messiah, are by far the most important to consider. They are most likely the names of Kings who ruled over Judea, from the Hasmonean Dynasty.

But first, I must explain why I qualify some of my statements with words (or phrases) like; "it is most likely," "probably," and "it could be." Sometimes I may be speculating about certain things in the scriptures that are expressed, which leave other things implied. But there's also certain historical events, cultural insights, syntax, idioms, and customs that give us clues about the life of Yahuahshua and the times he lived in. These clues can fill in some of the blanks and large chunks of missing information. You may be thinking, blanks? But the Bible is infallible! To that I must say, it is the word of Yahuah that is infallible. The Bible is a book that was assembled by men in 325 A.D., under the auspices of the pagan Emperor of Rome, Constantine the Great. 
Whether you face it or not, there is undeniable evidence which points to a consolidated attempt to erase most of the historical information about the life of Yahuahshua. There is also evidence that in the  4rth century scribes (or clerics) added verses to the scriptures to bolster or add meaning to official church doctrine. 
When I discovered this, was I distraught, or feel betrayed,  like I had misplaced my trust and built my faith on a stack of lies? Not at all! The entire book is not a lie. Yahuah would not leave this world without a witness of Himself; or without His word. Quite the opposite is true. The more I was able to flush out the pagan influence and lies, the brighter the picture became, the clearer my understanding.
 
Have you never wondered, why is it that everything we have written about Yahuahshua is a copy of a copy, that is a copy from another copy? Where are the original Hebrew manuscripts, written by the original Hebrew disciples, who were taught by the Hebrew Messiah? Why did Greek translations, like the Codex Vaticanus, replaced the Hebrew originals? And then, among these Greek manuscripts, why is it that the earliest ones are dated from around 350 A.D. Sure, there are some fragments that date as early as 80 or 90 A.D., but there are no complete letters, scrolls, or books; especially ones that are written in Hebrew.
There should be. It is nothing more than a simple exercise in grammar and composition, to prove beyond a doubt, that the New Testament gospels were originally written in Hebrew, yet no one copy has ever surfaced.

Consider this saying in John's gospel

And there are also many other things that Yahuahshua did, which if they were written one by one, I suppose that even the world itself could not contain the books that would be written. John 21:25 (NKJ)

I can read all of the words Yahuahshua spoke during his entire three year ministry (as recorded in Matthew's gospel) from my red letter edition of the Bible, in a little over one hour (and I'm a slow reader). Compare this to what the Apostle John said regarding the quantity of things done by Yahuahshua in his lifetime. Are we missing something?
I believe a missing piece to the puzzle can be found in Luke's gospel, in what appears to be the names of several Hasmoneans Kings. 
The Hasmonean Dynasty began, when
Mattathias ben Johanan, led a revolt against the Greco-Syrian empire in 167 B.C. 
The Hasmonean historical timeline fits with the scriptural timeline in the genealogy of Luke's gospel.

Luke's Gospel starting from the Babylonian captivity.....
Salathiel  
Zorobabel  
Rhesa  
Joanna  
Juda  
Joseph  
Semei  
Mattathias  
Maath  
Nagge  
Esli  
Naum  
Amos  
Mattathias This could very well be, Mattathias ben Johanan  
Joseph (?) 
Jannai

Alexander  Jannai  [killed 76 BCE] He was the Sixth Hasmonean priest to rule Judea.

Melchi (derivation of the) Hebrew word for "King."
Levi A Levite (Priest)
Heli (?)
Matthat Mattatayah Antigonus, the  ninth & last Hasmonean to claim control of Judea. . He was defeated in battle by Antipater's younger son, Herod (the Great). Antigonus allied himself with the Parthians, who were challenging Rome for control of Syria & Palestine. However, Herod was able to gain Roman support and with the help of Marc Antony, Antigonus was defeated. Jerusalem was captured by Herod in 37 BC and Antigonus was executed in 30 BC.
Joseph The natural father of Christ (Yahuahshua).
Christ born 4 B.C., before Herod the Great's recorded death.

Three of the names in Luke's genealogy point to the names of Hasmonean Kings. The names "Melchi" and "Levi" actually mean "Levite Kings," which is exactly what the Hasmoneans were.

Author JJ Raymond, in his book "Herodian Messiah," puts forth a unique and plausible theory that Joseph's wife Mary, was actually the daughter of Mattatayah Antigonus, the last Hasmonean King of Judea. If this were so, it would account for some of the names in Luke's genealogy, as well add another dimension to the Kingship of Yahuahshua. He may have been heir to the throne of Judea, as well as the throne of His Father's kingdom in heaven.

Why did the Parthian (Babylonian) Magi come to anoint Yahuahshua a King? The answer could be, they were more than just a bunch of star gazers. If King Mattatayah Antigonus was Yahuahshua's grandfather, they would have known of his royal lineage. Anitgonus had entered into an alliance with the Parthian Empire, and with their help (in 40 B.C.) he threw the Romans out of Judea (though his victory was short lived). In 37 B.C., the Romans regrouped and Jerusalem was recaptured. 
This is pure speculation but the Parthians could have sent this delegation of Magi to honor the grandson of Antigonus in hope that if he became King, he would honor the former alliance the Parthians had with his grandfather. Since the Parthians shared an east-west border with the Romans, it would be strategic for them to have a friendly Hasmonean King as the ruler of Judea.

This is why Pilate, a Roman soldier, mocked Yahuahshua by calling him, "The King of Judea." 
Pilate did not call him the "King of the Jews," as it says in most modern Bibles. This term would indicate that he was the leader of the Jews, as a people only. That's not what the Greek says. The word being translated is

"Ioudaios" (ee-oo-dah'-yos) [#2453] and means (in the sense of a country); Judaean, i.e. belonging to Jehudah: 

Pilate asked him plainly; Are you the King of Judea? 

So Yhwhswa said to him, "It is as you say." Matt 27:11 (NKJ)

He answered and said to him, "It is as you say." Mark 15:2 (NKJ)

He answered him and said, "It is as you say." Luke 23:3 (NKJ)

Pilate was not concerned about Yahuahshua laying claim to some future heavenly kingdom. He was referring only to the here and now.

On the day that would become known as "Palm Sunday," why did the Hebrews in Jerusalem receive him as the King of Israel;

[the people in Jerusalem] Took branches of palm trees, and went forth to meet him, and cried, Hosanna: Blessed is the King of Israel that cometh in the name of Yahuah. John 12:13 (KJV)

Only Rome could bestow the title of King upon a man. To otherwise call yourself a King, without Rome's approval, was sedition. Yet, we see this exchange in the scriptures between Yahuahshua, Pontius Pilate, and the Pharisees;

Then the whole multitude of them arose and led Him to Pilate. And they began to accuse Him, saying, "We found this fellow perverting the nation, and forbidding to pay taxes to Caesar, saying that He Himself is Christ, a King." Then Pilate asked Him, saying, "Are You the King of the Jews?" He answered him and said, "It is as you say." So Pilate said to the chief priests and the crowd, "I find no fault in this Man." Luke 23:1-4 (NKJ)

Here in these verses, Yahuahshua calls himself a King, and the Roman Procurator says, "I find no fault in this man." What is going on?

His title "King," may have meant more than just His future role as "King of Kings" (at his second coming). If his mother Mary (Miriam in the Hebrew) were the last Hasmonean Princess, he would have legally deserved the title, "King" in his natural life. This would have been the primary reason for recording Mary's genealogy. Although Hebrew law dictates that only the Patriarchal lineage be counted; a man born of a Princess was indeed a Prince with a legal claim to be King.

When the Virgin Birth Doctrine is placed under close scriptural scrutiny, it is evident to me that it was adopted by the Roman Catholic Church in the fourth century. It
was not even given a thought in the first official meeting to organize the church, at the Council of Nicea, with Roman Emperor Constantine presiding (shown below);

First Council of Nicea (325) 
The Nicean Creed

We believe in one God, the Father Almighty, Maker of all things visible and invisible.
And in one Lord Jesus Christ, the Son of God, begotten of the Father [the only-begotten; that is, of the essence of the Father, God of God], Light of Light, very God of very God, begotten, not made, being of one substance with the Father; By whom all things were made [both in heaven and on earth]; Who for us men, and for our salvation, came down and was incarnate and was made man; He suffered, and the third day he rose again, ascended into heaven; From thence he shall come to judge the quick and the dead.
And in the Holy Ghost.
[But those who say: 'There was a time when he was not;' and 'He was not before he was made;' and 'He was made out of nothing,' or 'He is of another substance' or 'essence,' or 'The Son of God is created,' or 'changeable,' or 'alterable'—they are condemned by the holy catholic and apostolic Church.]

But 56 years later, in 381 A.D., the Council of Constantinople did amend the Nicean Creed to say:

First Council of Constantinople 

We believe in one God, the Father Almighty, Maker of heaven and earth, and of all things visible and invisible. And in one Lord Jesus Christ, the only-begotten Son of God, begotten of the Father before all worlds (æons), Light of Light, very God of very God, begotten, not made, being of one substance with the Father; by whom all things were made; who for us men, and for our salvation, came down from heaven, and was incarnate by the Holy Ghost of the Virgin Mary, and was made man; he was crucified for us under Pontius Pilate, and suffered, and was buried, and the third day he rose again, according to the Scriptures, and ascended into heaven, and sitteth on the right hand of the Father; from thence he shall come again, with glory, to judge the quick and the dead;
whose kingdom shall have no end.
And in the Holy Ghost, the Lord and Giver of life, who proceedeth from the Father, who with the Father and the Son together is worshiped and glorified, who spake by the prophets.
In one holy catholic and apostolic Church; we acknowledge one baptism for the remission of sins; we look for the resurrection of the dead, and the life of the world to come. Amen.


I find it strange that although the Christian Church at large considers the virgin birth doctrine to be the single most important aspect of the nature of Christ,  it wasn't defined until the year 381 a.d. Surely the Apostles that lived and walked with Yahuahshua would have known of His extraordinary and miraculous birth! It stands to reason that the nature of His birth, death, and resurrection would have been the main tenets of the faith, and they would have been defined early on.

More proof that this doctrine was adopted later on, as a way to explain how the Messiah could be both man and God. It arose from a total lack of understanding regarding the three types of bodies described in the scriptures. 

Those who support the virgin birth doctrine usually do so for two reasons;

1.  Because they believe that Yahuahshua's conception could not have been through sexual intercourse, because he would have inherited the sin cursed blood of man. 
2.  Because sex is dirty, and Yahuah's Son could not have been born as a result of this act.

On the second point, I can only say that Yahuah created the sex act so that a husband and wife, although two separate persons, could become one flesh. Sexual intercourse is the physical manifestation of a oneness that should already exist spiritually. If Joseph and his wife Mary, played a part in bringing forth the Messiah through Yahuah's sanctified method of procreating life, how could that be "dirty" or opposed to Yahuah's will? In my opinion, those who think this way have a personal problem with sex that is totally unfounded in the scriptures (and thus - false).

On the first point, I agree, Yahuahshua could not have been born into a mortal body. Which is why it is so important to distinguish between the three type of bodies. He was born with the original holy blood of an immortal body. Holy because it was formed prior to sin, at the time when Adam was created.
Adam and mankind both possessed what can only be called in biological terms, a "closed" system. This closed system was none other than their individual bodies. During the adulterous act of Eve and Nachash; components (DNA) from each of their separate bodies, mingled and became one in their offspring. Yet, present within that offspring was all of the DNA unique to each one of the parents. Its a biological fact that after fertilization takes place in the ovum, when all 46 chromosomes of both parents are present, certain genetic traits (organized by sequences) are expressed while others are suppressed. 
In the case of the 2nd Adam (Messiah), only the genetic sequences producing the proprietary code for immortal life, were expressed. All of the DNA coding for mortal life was suppressed. This activity, described as gene expression and suppression can actually be performed by scientists today. The technology is called RNA Interference. If man can do this through manipulation, then it is reasonable to conclude, that in the process of time (and according to the Law of Probabilities) under the right circumstances, it would have occurred naturally. What are the right circumstances? The answer is found in the reason why the Gallilean Hebrew genome was watched over and preserved by Yahuah. The post Babylonian genome of Judah was mostly polluted, as recorded in the book of Ezra. Just as Noah was a man perfect in his pedigree, so was Nathaniel;

Yahuahshua saw Nathanael coming to him, and saith of him, Behold an Israelite indeed, in whom is no guile! John 1:47
(KJV)


The Greek word being used for "guile" is "dolos" and means "a trick" or "decoy." Yahuahshua was saying, 'Behold a true Israelite (of Joseph and Ephraim) and not a decoy! Nathaniel, like Noah, was pure Hebrew in his pedigree.

If Yahuah intended from the beginning to have the Holy Spirit bring a "Y" chromosome to Mary the Mother of Yahuahshua, in a virgin conception, why was he intent on preserving the seed line of Eve, and the Hebrews in general? Because the entire redemption process was completed from within, from what he had already created during the six days of creation.Yahuah rested from all of his work, and later testified (through Solomon) that there is nothing new under the sun. He created powers, principalities, and dominions to serve Him and his Creation. But the most remarkable aspect of His plan is, not only do they serve him, he also abides by them. When he looked back on creation and saw the finished product, he saw that everything was "very good." Did he not see the evil day coming? Of course he did, but he also saw the restoration and the finished product. He did not have to pull a rabbit out of his hat to fix anything. He worked within the system he ordained. He did not take an eraser and remove Adam's name from the blackboard of Creation. Yahuah is much greater than that, He restored creation through His superior wisdom.
If a virgin birth was necessary to avoid sin, then why didn't Yahuah just start out with this method. Why didn't he make Eve first (or Mary for that matter) and by the power of His Holy Spirit cause her to conceive. She could have been the progenitor of a race descended directly from the Father. 
If you can answer this question, then you should be able to see through the folly behind the virgin birth doctrine.


In the simplest of terms, I see the two "closed" systems being mixed together just like water with olive oil. They will stay mixed as long as you shake them, but they can be separated. Just like RNA Interference therapy, some genes can be expressed while others are suppressed.
An example of this separation occurs at the Marriage at Cana, when the water was turned to wine. 

Now there were set there six waterpots of stone, according to the manner of purification of the Hebrews, containing twenty or thirty gallons apiece. John 2:6 


Six is the number of man made on the sixth day. The six 20 or 30 gallon water pots were used for the purification practices of the Levitical priests. Yahuahshua, being Mary's son and a descendant of Levi, was a Levitical priest. By changing the water into wine, the best wine, he was giving us a simile of how his body was purified from the defects of mortality, into the form of the original immortal body (which was made from spiritual water).
Just as water and oil do not mix, all of the components of the immortal body (like water) were separated out from the combined systems that had become "fallen" man.
This is what enabled Yahuahshua to be born with the same body as the first Adam.
His first recorded miracle is an allegory of what he actually did first in real life, in himself, by the power of his own birth.

"Yhwhshua (Christ) said to the servants, "Fill the jars with water"; so they filled them to the brim. Then he told them, "Now draw some out and take it to the master of the banquet." They did so, and the master of the banquet tasted the water that had been turned into wine. He did not realize where it had come from,."John 2:7-9

This was much more than Yahuahshua testing his wine making skills. His unique body combined the living spiritual waters of Yhwh to form a holy blood; the same blood that Adam had, which was untainted by sin or any mortogenic (or death) factor. The immortal gene sequence was "expressed," While the mortal gene sequence was "supressed."

This is he that came by water and blood, even Yahuahshua hamashiyach (Messiah); not by water only, but by water and blood. I Jn 5:6 (KJV)

Not by water only, meaning he wasn't just an angel or spirit being, or a "Y" chromosome inserted into Mary's ovum and then incubated for nine months. He was made from the waters of immortality, just as Adam was.

"His purpose was to create in himself one new man out of the two, thus making peace, and in this one body to reconcile both of them to Yhwh through the cross, by which he put to death their hostility (enmity)." Eph 2:15-18

This is a strange saying, "one new man out of the two!" What does Paul mean? He is referring to the two different types of bodies, made for the two different original species, that by way of sin; became one mortal body. Yahuahshua would bring forth from these two bodies that were placed under bondage to mortality, one new man; an eternal man.
By referring to the "hostility" (or enmity) Paul is directing us straight back to Genesis; where the hostility is the hatred that Yahuah placed between the two seed lines (or lineages);

And I will put enmity (hatred) between thee (nachash) and the woman (Adam’s wife) and between thy seed and her seed; it shall bruise thy head, and thou shalt bruise his heel. Gen 3:15

You can see how the scriptures linguistically differentiates between these two different seed lines. When Yahuah removes both "Adam" and "mankind" from the garden of Eden, He addresses them in different terms:

Therefore Yahuah sent him (proper name - Adam) forth from the garden of Eden, to till the ground from whence he was taken (Gen 3:23).  

Here Yahuah "sent" Adam away.

In the next verse:

"...he drove out the man (mankind) and he placed at the east of the garden of Eden Cherubims, and a flaming sword which turned every way, to keep the way of the tree of life." Gen 3:24

Then, Yahuah "drives out" mankind!  

I d
eclare to you, brothers, that flesh and blood cannot inherit the kingdom of Yhwh, nor does the perishable inherit the imperishable. 1 Cor 15:50 (NIV)

Adam, Eve, Nachash, and his wife, in their perishable (mortal) form were not permitted to eat from the tree of life and become imperishable (eternal).
No one, in a sinful state, who is being ruled by their sinful nature, alienated from Yahuah in body and mind, can inherit eternal life.  

But as many as received Him, to them He gave the right to become children of Yahuah, to those who believe in His name: who were born, not of blood, nor of the will of the flesh, nor of the will of man, but of Yahuah. John 1:12-13 (NKJ)


Yahuahshua answered, Verily, verily, I say unto thee, Except a man be born of water and of the Spirit, he cannot enter into the reign of Yahuah. John 3:5 (KJV)

The "spiritual" water that I equate with the plasma (or main component) of the Holy blood formed in Yahuahshua at his conception, is a repetitive theme in the scriptures. This water denotes the power of Yahuah as a source of life - itself.

Yhwhswa answered and said to her, "If you knew the gift of Yhwh, and who it is who says to you, 'Give Me a drink,' you would have asked Him, and He would have given you living water." John 4:10 (NKJ)

This water is alive!

"...but whoever drinks of the water that I shall give him will never thirst. But the water that I shall give him will become in him a fountain of water springing up into everlasting (eternal) life." John 4:14 (NKJ)

This water is eternal!

Then the angel showed me the river of the water of life, as clear as crystal, flowing from the throne of Yhwh and of the Lamb Rev 22:1 (NIV)

The word used above for flowing (or proceeding out of) denotes the place or point of origin. 
The throne of Yahuah is related to (or explicitly means) "the power of Yahuah." So then it could be said that, flowing from the place in which Yahuah's power originates from, is the water of life.

"For My people have committed two evils: they have forsaken Me, the fountain of living waters, and hewn themselves cisterns-- broken cisterns that can hold no water. Jer 2:13 (NKJ)

This is the story of Adam and Eve in a single sentence. It is not more complicated than this. Adam and Eve did forsake Yahuah and his living waters, to make for themselves a "hybrid" cistern (or body) in which there is no eternal life, because it cannot hold Yahuah’s water. 
This is the same water that Yahuahshua's immortal body held;

....one of the soldiers pierced His side with a spear, and immediately blood and water came out. John 19:34 (NKJ)

Therefore with joy shall ye draw water out of the wells of salvation.
Isa 12:3 (KJV)


In contemplating the physiology of the immortal body I have to wonder, did Adam and Eve possess the same internal organs we have today? In an immortal state, would they have needed all of the internal organs we now have. In light of that question, which organs will we possess in our resurrected or glorified bodies? Our internal organs exists (basically) to supply oxygen to the brain, and deliver nutrients to our body (while eliminating impurities). But when we live in an eternal body, one that is free from impurity, why would we need most of them? Or any of them for that matter.
I'd much rather have a body of flesh and bone, filled with the water of life; then energized by the life force of Yahuah, and covered in His light.

We can gain some insight into this, and what the eternal body will be like, by looking at the office of the High Priest and the garments he wore. Only the High Priest could enter the Holy of Holies (the inner sanctuary) of Solomon's temple. That is where the shekinah glory (the light-energy of Yahuah) shined on the ark of the testimony. The shekinah glory was the manifestation of Yahuah's presence on earth. The High priest, in order to be in Yahuah's presence (and inside of the Holy of Holies) was required to wear the garments shown below, as described in the book of 2 Kings..

 

The Ephod

Notice the breastplate (with the 12 gemstones) was placed over the center of the chest.
It represents the spectrum of white light. This light in turn, represents a heart of pure energy, that will one day replace the heart that pumps blood.

"Bless Yhwh, O my soul! O Yhwh my Ul, You are very great: you are clothed with honor and majesty, who cover Yourself with light (energy) as with a garment,.." Ps 104:1-2 (NKJ)

The Menorah is also symbolic of this "heart" of pure energy (white light) emanating from the center of the ribcage. The design for the original Menorah was given to Moses. Although many of the technical aspects of the Menorah were recorded in  Exodus 25:31-40, the actual shape was shown only to Moses on top of Mount Sinai - by Yahuah himself. This perspective is what is needed to bring the 2 dimensional specifications into a 3 dimensional view. The original Menorah was carried away by the Babylonians about 586 B.C. The Book of Ezra says that all of the gold and silver vessels from the House of YHWH were returned. I assume that means the original Menorah, but I have my doubts.
When the Romans sacked Jerusalem in 70 A.D., they took the Menorah from the Temple in Jerusalem and brought it back to Rome. The monument known as the "Arch of Titus" located in Rome, commemorates the Fall of Jerusalem and depicts the Menorah being carried by Roman soldiers in a Victory procession.

This is how the Menorah is depicted on the Arch of Titus.


I doubt this is the original design because of the instruction given in the Book of Numbers. Pay special attention to the placement of the lamps (or bowls) in relation to the lamp stand (Menorah).

And YHWH spoke to Moses, saying:

"Speak to Aaron, and say to him, 'When you arrange the lamps, the seven lamps shall give light in front of the lampstand.'"
And Aaron did so; he arranged the lamps to face toward the front of the lampstand, as YHWH commanded Moses.

The design calls for the seven lamps (actually bowls) to face toward the front of the lamp stand ,so the light illuminates the lampstand. How could this be accomplished by the usual and accepted model (shown above) where the bowls are situated directly to the side of the lamp stand's middle shaft

I picture the Menorah in the shape of a ribcage, where the lamp stand is the spinal column. The bowls sit where the ribs connect to the sternum, casting their light in front of the candle stand.

This is another picture of how one day Yahuah's self existent energy will emanate from the center of our being.

               

The 22  almond blossoms, with an ornamental knob and flower (Exodus 25:31) most likely represent the vertebrae of the spinal column that will blossom (at the resurrection) just as Aaron's rod blossomed in the Ark of the Covenant. 
The second reason why I believe contemporary Menorah designs are flawed  is because of the instructions shown below;

Now this workmanship of the lampstand was hammered gold; from its shaft to its flowers it was hammered work. According to the pattern which YHWH had shown Moses, so he made the lampstand. Num 8:1-4 (NKJ)

The entire Menorah was to be hammered out of one piece of gold. Gold is a soft metal, and the outstretched branches of the typical Menorah design will droop under its own weight. To my knowledge, there has not been a reproduction made according to strict Biblical guidelines for this very reason. The most current reproduction that I've seen, had each separate branch reinforced by a steel core that bolted to the stand. Although I have not built a reproduction myself, I don't believe the "ribcage menorah" would have this problem, because the bowls (or lamps) are located next to the sternum, which should be able to hold the weight (as illustrated above.

Look again at the High Priest's ephod, which is the vest like garment which is worn over the robe. It was designed to cover the human internal organs from the top of the lungs down to the groin. This is not coincidental. In my opinion, this points to a time when these organs will not be needed. 


There are other clues that give us an insight into the form and function of the eternal body.
Think again about the simile concerning the Olive tree and the fig tree. How the leaves of the olive tree grow directly opposite one another on the branch, and resemble DNA. While the fig tree leaves are in the shape of the human hand. 

There is another simile to be found, only this one is in the Hyssop tree. It relates to the two different types of bodies. Hyssop tree branches have a great deal of significance in the scriptures. Their leaves also grow directly opposite one another in a similar fashion to the olive tree.
Hyssop was used by the Hebrews during the Exodus from Egypt. 
On Passover, they placed the lamb's blood upon the door posts and lintel of their homes using hyssop branches. They did this so they would live and not be killed. This symbolized the Messiah's blood that would also be shed (from his immortal body) so that others could live.

"And you shall take a bunch of hyssop, dip it in the blood that is in the basin, and strike the lintel and the two doorposts with the blood that is in the basin. And none of you shall go out of the door of his house until morning. Exod 12:22 (NKJ)

In this diagram you can see that hyssop leaves grow in two sets of three, directly opposite one another. With one longer leaf, accompanied by two smaller leaves (one on each side).




Diagram #1 (below) is an enlarged view of a leaf section.

Diagram #2 is a flat drawing of a leaf section.

In diagram 3 I've connected the tips of the leaves to form a six pointed star (or Star of David) with an interior six sided (or hexagonal) shape.  




These shapes have significance. 
They appear repeatedly in the scriptures, as I'll demonstrate later.

If you think of the hyssop tree leaves as a likeness of DNA, and the immortal body, a different interpretation of these scripture verses stands out:

Now a vessel full of sour wine was sitting there; and they filled a sponge with sour wine, put it on hyssop, and put it to His
[Yahuahshua's] mouth.
So when Yahuahshua had received the sour wine, He said, "It is finished!" And bowing His head, He gave up His spirit. John 19:29-30 (NKJ)

...they gave Him sour wine mingled with gall to drink. But when He had tasted it, He would not drink. Matt 27:34 (NKJ)


Yahuahshua was offered sour wine (or vinegar) to drink on a hyssop branch, but he refused to drink it. The hyssop branch was a picture of the immortal body, the sour wine was symbolic of our blood which is "soured" with mortality (caused by sin). In the Garden of Eden, our ancestral parents were given the same choice, and they choose to change their immortal blood into "vinegar." 

Yahuahshua rejected the vinegar when it touched his lips, and did not partake of sin. 

On the contrary, Yahuahshua (in a sense) dipped his hyssop branch (immortal body) into the spiritual water, and made it into the original immortal blood symbolized by the wine, and untainted by sin.

What might seem like a minor event, or something that the disciple happened to remember about that day, really has a much deeper meaning. In my mind, these things testify to the fact that Yahuah is in control of even the smallest detail. All of which point to Yahuahshua, and how he reversed the curse of sin and death.  

Here is another simile that illustrates the difference between the two types of DNA that were mixed together when Adam and Eve commingled their DNA with that of mankind's.

And unto Adam he said,...cursed is the ground for thy sake; in sorrow shalt thou eat of it all the days of thy life; Thorns also and thistles shall it bring forth to thee; and thou shalt eat the herb of the field; Gen 3:17-18 (KJV)

This curse, which brought about the thorns and thistles, has a dual meaning. The first meaning is the obvious one which refers to agriculture. The second one refers to the genome of immortal life. What Adam and Eve did was like introducing thorns and thistles into their bodies and seed line.

                                                      
And the soldiers twisted a crown of thorns and put it on His head, and they put on Him a purple robe. John 19:2 (NKJ)

The Ram's horn (Shofar) is also a picture of the DNA of immortal life. 

The Hebrew word for "horn" is "qeren" (keh'-ren); and also means (figuratively) power: Another Hebrew word for "power" also alludes to the ram's horn. This word,  'uwl (ool) [#193] means to twist, (like a ram's horn) be strong; the body (as being rolled together); also powerful. 

                                
               

The idea of being twisted (as rolled together) is a perfect definition for the left handed twist of DNA.  
Put two ram's horns side by side in the vertical position, and it looks just like DNA.

                                                       

When Abraham was preparing to offer his son Isaac, Yahuah stopped him because Isaac's sacrifice in a mortal body could not have reversed the curse of sin and death. 

And Abraham lifted up his eyes, and looked, and behold behind him a ram caught in a thicket by his horns: and Abraham went and took the ram, and offered him up for a burnt offering in the stead of his son. Gen 22:13 (KJV)


                                             


This is a picture of the children of Yahuah. They are symbolized by the Ram's horn, which is a picture of the strength of Yahuah and the immortal DNA.
The immortal DNA has been snared, caught in a crown of thorns (mortal DNA).

But thank Yahuah, we are saved by the one who wore those thorns on his head, but
never introduced them into his body! 

Another glimpse of this is seen in Exodus chapter 3, when Moses encounters the burning bush. 

And the angel of Yhwh appeared unto him in a flame of fire out of the midst of a bush: and he looked, and, behold, the bush burned with fire, and the bush was not consumed. Exod 3:2 (KJV)

The word for bush in the Hebrew,  is "cenah" and means; a bramble, thicket (or to prick).
So, the burning bush is a thorn bush. The fire that engulfed the thorn bush without consuming it is "'esh" in the Hebrew, and pronounced "aysh."

The Hebrew word for "man" is "Iysh," pronounced "eesh." It is spelt (from right to left) aleph, yod, and shin.
The Hebrew word for "woman" is "ishshah," pronounced "ish-shaw." It is spelt aleph, shin, and hay (shown below).

The Hebrew language uses male and female modifiers to add gender to a pronoun. If you remove the male modifier from the word  "man," and the female modifier from the word  "woman;" you are left with the word fire, "aysh." The same fire that burned in the bush. 

This is another picture of Yahuahshua and the "fire of Yahuah," the light-energy that surrounded the first man and woman, Adam and Eve. 
The spectacle that Moses saw was a picture of the 2nd Adam who was coming to dwell in the likeness of a thorn bush, yet with the fire of Yahuah in his heart. 
Only one time, on the Mount of Transfiguration did Yahuahshua reveal his true physical nature, that he was covered in light. In order for him to appear to be in "the likeness of (mortal) man" he took on the appearance a mortal man (the thorn bush).

"Is not My word like a fire (aysh)?" says YHWH, "And like a hammer that breaks the rock in pieces? Jer 23:29 (NKJ)


The fallen nature of the body, as well as the work that Satan carried out in the Garden of Eden is summarized in Matthew 13;

Another parable He put forth to them, saying: "The kingdom of heaven is like a man who sowed good seed in his field; "but while men slept, [while men were unattentive, unconcerned] his enemy [the adversary, Satan] came and sowed tares among the wheat and went his way.

This is pure allegory. The "seeds" being referred to here are not necessarily of the garden variety. The Greek word being translated as "seed" is Strong's word #4690; sperma (sper'-mah); meaning something sown, i.e. seed (including the male "sperm"); by implication, offspring; specifically, a remnant.

"But when the grain had sprouted and produced a crop, then the tares also appeared. "So the servants [angels] of the owner [Yhwh] came and said to him, 'Sir, did you not sow good seed in your field? How then does it have tares?' "He said to them, 'An enemy has done this.'  (NKJ)

Tares are a kind of "darnel" and known as degenerate wheat. It grows in grain fields and resembles wheat, but darnel seeds are poisonous to man and animals.

The word "slept" in Hebrew [yashen] means to be slack (by implication, to sleep) also, to be disinclined to exert oneself physically, which denotes more of an attitude of laziness that a state of being asleep. "While men slept" the enemy used this opportunity to sow a degenerate seed (named Cain). 
Another picture of what took place in the Garden of Eden can be seen in what occured in the Garden of Gethsemane. The second Adam (Yahuahshua) asked his disciples to stay awake (be vigilant) with him and pray. [In a similar way the first Adam was asked to guard and protect the garden.] 
Instead they all slept. Twice he asked His disciples, to no avail. But there was one among the twelve that didn't take a nap. The one who betrayed him, Judas Iscariot. Which makes me wonder, why is it that the righteous sleep while the wicked plot and scheme?


Fruit of the Counterfeit Reality.

Genesis Chapter 6 describes other lawless acts that took place as a result of Adam's fall and Satan’s subsequent take over.

And it came to pass, when men began to multiply (increase in number) on the face of the earth, and daughters were born unto them, that the sons of Yhwh saw the daughters of men that they were fair (attractive); and they took....... 

The phrase, "and they took," as stated here in this verse, is Strong's word #3947, "laqach." In this context it means they grabbed, seized, carried away, and raped, the daughters of men.

This word "laqach" is the same word that is applied to the rape of Dinah (Jacob's daughter);

And Dinah the daughter of Leah, which she bare unto Jacob, went out to see the daughters of the land. And when Shechem the son of Hamor the Hivite, prince of the country, saw her, he took  her [laqach], and lay with her, and defiled her. Gen 34:1-2 (KJV)

Genesis Chapter 6 verse 2 continues;

"...and they took them wives (naw-sheem, a mortal woman) of all which they chose. And Yahuah said, My spirit shall not always strive with man, for that he also is flesh: yet his days shall be an hundred and twenty years. There were giants [nephiyl (nef-eel'); meaning a feller, bully, or tyrant]  in the earth in those days; and also after that, when the sons of Yahuah came in unto  (hebrew word - bow' el') the daughters of men (had sexual intercourse) and they bare children to them, the same became mighty men (gibbowr (ghib-bore'); or gibbor; meaning powerful; by implication, warrior, tyrant) which were of old, men of renown.

The sons of Yahuah refers to the angels of Yahuah. And they "took" wives for themselves of all whom they chose indicates that the daughters of men were carried off or seized, as opposed to being married. The sons of Yahuah came in to the daughters of men means "to enter unto a woman, to have intercourse." The hybrid children of this transmutation are referred to as the Nephillim. Jude refers to these "fallen" angels as those who left their first estate, their place of habitation:

"And the angels who did not keep their proper domain, but left their own abode, He has reserved in everlasting chains under darkness for the judgment of the great day;" Jude 1:6 (NKJ)

These are the angels who left the spirit realm to rape the daughters of men. Jude compares these angels with the people of Sodom and Gomorrah who "went after strange flesh."  

"as Sodom and Gomorrah, and the cities around them in a similar manner to these, having given themselves over to sexual immorality and gone after strange flesh, are set forth as an example, suffering the vengeance of eternal fire." Jude 1:7 (NKJ)

The people of Sodom and Gomorrah committed bestiality by going after strange or different flesh; (meaning the flesh of animals). In the same way, some of the angelic beings went after the different flesh of the daughters of men. So the lawless act that first took place between Eve and Nachash became the precedence for others of the same nature.

The Book of Enoch describes in detail angels consorting to commit this sin (Chapter 6-11). It is interesting to note that there were 5 copies of the Book of Enoch found among the Dead Sea Scrolls. While most Christian denominations and many scholars dismiss this book as uninspired (as well as many other "non-canonical" books) there were more duplicates found of this book at Qumran, among the Dead Sea scrolls, than of any other book of the Bible. Somebody must have liked it!
The book of Enoch was read by many 1st century Hebrews (including the Essenes). If you throw out the Book of Enoch, you should also throw out the epistle of Jude. Obviously the writer had read and believed in the message of Enoch. Some say that the book of Enoch is "Hellinized" and reflects Greek thought more than Hebraic thought. Many scholars date this book around the time of the Babylonian captivity (6th century BC) or earlier; which predates any possibility of Greek influence. There are many scholarly and conclusive opinions regarding the influence the Book of Enoch has had on New Testament writings. You should read this book if for no other reason than the pagan Roman Emperor Constantine (a high priest of the god Apollo) ordered this book removed from the Canon of scripture (at the Council of Nicea in 325 A.D.) 
What's in it that he didn't want you to know?  Why is it that even today, Church leaders of all denominations disregard this book, and don't want you to read it?

The Book of Enoch
Chapter 6.

And it came to pass when the children of men had multiplied that in those days were born unto them beautiful and comely daughters. And the angels, the children of the heaven, saw and lusted after them, and said to one another: 'Come, let us choose us wives from among the children of men And all the others together with them took unto themselves wives, and each chose for himself one, and they began to go in unto them and to defile themselves with them, and they taught them charms and enchantments, and the cutting of roots, and made them acquainted with plants. And they became pregnant, and they bare great giants, whose height was three thousand ells: Who consumed all the acquisitions of men. And when men could no longer sustain them, the giants turned against them and devoured mankind. And they began to sin against birds, and beasts, and reptiles, and fish, and to devour one another's flesh, and drink the blood. Then the earth laid accusation against the lawless ones.

This Chapter goes into more detail than Genesis chapter 6, but the message is the same. The Book of Enoch and the scriptures agree; that a hybrid race of creatures were created by the fallen angels.
Notice that the giants were in the earth (during those days) and also afterwards. Since the giants were destroyed in the flood, the Book of Enoch tells us how their influence and very presence has remained on the earth.

And now, the giants (Nephillim), who are produced from the spirits and flesh, shall be called evil spirits upon the earth, and on the earth shall be their dwelling. Evil spirits have proceeded from their bodies; because they are born from men and from the holy Watchers is their beginning and primal origin; they shall be evil spirits on earth, and evil spirits shall they be called. [As for the spirits of heaven, in heaven shall be their dwelling, but as for the spirits of the earth which were born upon the earth, on the earth shall be their dwelling.] And the spirits of the giants afflict, oppress, destroy, attack, do battle, and work destruction on the earth, and cause trouble: they take no food, but nevertheless hunger and thirst, and cause offences. And these spirits shall rise up against the children of men and against the women, because they have proceeded from them. Enoch 15

These evil spirits are referred to in NT writings as, "demons." They are not the fallen angels themselves who have been imprisoned (as described in Jude's Epistle) but rather, they are the offspring of the illicit union between the fallen angels (watchers) and the daughters of men. 
They are the disembodied Giborim.

The Fallen angels committed these acts in an attempt to destroy the lineage of Eve and her pedigree (which included the promised Messiah). If Yahuah had not made a provision for Noah, they would have succeeded in corrupting and defiling the complete bloodline of man. 

Noah was a just man, perfect in his generations. Noah walked with Yhwh. Gen 6:9 (NKJ)

"Perfect in his generation" means (in the Hebrew) "perfect" in his "pedigree," or family lineage
He was not "Nephillim.". His blood had not been defiled with that of the Nephillim, or more precisely, with their offspring, the Giborim. Also called  "the mighty men of renown" referred to in Genesis 6:4.

These are the tribes of the descendants of the Nephillim, mentioned in the Old Testament, along with the meaning of their names.

Caphtorims - to encircle.
Horims - cave dwellers
Zophims - watchers, to observe.
Seirims - devil, he-goat hairy.
Emims - terror, fright, horror, fear.
Zumzuzims - to plan devise evil.
Anakims - to choke (necklace).
Zuzims - a wild beast.
Repaims - a giant (dead).
Shedims - a devil, demon, insolence, waste.
Gammadims - a warrior, to grasp.

The definition of their Hebrew names says a lot about their character and nature. The Hebrews who left Egypt during the Exodus encountered the last branch of these giants in existence.

Theologians (in general) disregard this entire topic. My guess is, it would be too unpleasant to address the congregation with a story about angels raping women to pollute the human genome.  Whatever the reason may be for their silence on this subject, it is nonetheless an important area of study. I can tell you for sure that Yahuahshua did not hesitate to point out the significance of Genesis chapter 6 and its meaning for the last days;

"As it was in the days of Noah, so it will be at the coming of the Son of Man." Matt 24:37

If the purpose of this prophecy was to point out how sinful and wicked the world would become in the Last Days;  then He could have said,  'As it was in the days of Sodom and Gommorah,’ or  ‘in the days of Tyre and Sidon.’ We would have known exactly what he meant. These cities were destroyed for their wickedness, corruption, and immorality. Instead, he uses the time of Noah in this prophecy to direct our attention to Genesis chapter 6. To alert us to the return of the Nephillim and other Satanic hybrids. That is the difference between Matthew 24:37 and all other examples. It is the distinction given to Noah's day that nothing else can compare to. 

The science needed for the return of the Nephillim and the Gibborim  is now available! Our day has become - the Day of Noah.


Read this short article by John Morris of the Institute for Creation Research. It is about this subject matter.

Who were the "Giants" in the Days of Noah? (#158)
by John Morris, Ph.D.

Abstract

I suspect that if today's geneticists and molecular biologists can accomplish such technical wonders as gene splicing and cloning, that the much greater intelligence of Satan could potentially have done it too. "There were giants in the earth in those days; and also after that, when the sons of God came in unto the daughters of men, and they bare children to them" (Genesis 6:4). Few passages in all of Scripture have yielded so many interpretations as Genesis 6:1-5. Who were the "sons of God"? Who were the "daughters of men"? Why would their union produce giants and be associated with great wickedness? Some have proposed that the "sons of God" were the descendents of Adam's son Seth, and the "daughters of men" were from the line of rebellious Cain. An interesting thought, but in Noah's day there were essentially no righteous people, from any line. Others have rightly noted that the term "sons of God" in the Old Testament refers only to angels, thus these must be the fallen angels. Satan had launched an aggressive campaign against Adam and his descendents in an attempt to so pollute mankind that the promised Redeemer, the "seed of the woman" (Genesis 3:15) could not come. But angels in Scripture are spiritual beings having no permanent body, and in heaven, at least, they do not "marry" (Matthew 22:30). And just what would this half angel/half man be? Would it be a giant, and more importantly, would it have an eternal spirit? Let me suggest another alternative from our modern-day understanding of genomics, one which Bible scholars of yesteryear could not have suggested. The inner workings of the DNA molecule would not have been hidden from the prying eyes of Satan and his henchmen. If today animal genes can be inserted into human DNA, could not it have been accomplished by malevolent spiritual beings bent on destruction of the "image of God"? Obviously we cannot speak with certainty, for the Bible gives little detail. At the very least, Satan's demons could have selected and indwelt certain men and women, and performed selective breeding experiments to produce over the generations a race of giants. (He could have done the same with animals too, and maybe that's where some of the unthinkable features we see in the fossil record come from. This could represent Satan's rage in trying to fully destroy any vestige of God's once "very good" creation.) Could he not have inserted genes and fabricated clones, mocking and ruining God's majestic handiwork? Perhaps this is why God had to send the Flood, eradicating a civilization beyond repair and starting anew with Noah, preserving the true seed of Adam. One more thought. Christ compared the days of Noah to the days prior to His return. Are the actions which produced "giants," whatever they were, considered in this comparison? Certainly at no prior time of history have humans been able to "play God" with the genome as they do now. The rush to embrace the ghoulish possibilities of cloning and embryonic stem cell manipulation may be reminiscent of that long ago time. God's utter condemnation of that effort may help us evaluate modern experiments.

http://www.icr.org/index.php?module=articles&action=view&ID=540


 The Temple and the Last Days.

What significance does the rebuilding of Solomon’s temple have in the last days? 

Many Christian theologians, preachers, and tel-evangelists espouse the belief that Solomon's temple must be rebuilt prior to the reign of anti-Christ (the Son of Perdition) and the subsequent return of Yahuahshua. This may not be true at all. There is more implied by the word "temple" than just a stone structure.  I realize the social and religious ramifications centered around the prospect of rebuilding Solomon's temple. With that in mind, the anti-Christ and his New World Order will most likely use the idea of rebuilding the temple, as a  tool for Political manipulation. Nonetheless, whether or not Solomon's temple is rebuilt, will not make a difference in the "Last Days" timetable. The temple that Yahuahshua referred to has already been rebuilt. The dwelling place of Yahuah is now the physical body of each one of His children. 

The original temple was a shadow of the Messiah that was to come. Hidden in plain site was Yahuah's plan for the redemption of man. 
The two original stone tablets given to Moses and broken into pieces, just like the bodies of Adam and Eve; were stored inside the ark of the testimony, under the mercy seat.  The Shekinah glory lit the inner sanctuary that held the ark. This light represented the presence of Yahuah, the spark or fire of life. 
Yahuah is, "the Father of Spirits," [ Numbers 16:22; Hebrews 12:9]
Only Yahuah can create life, and then endow that person with a spirit; just as He breathed into Adam's nostrils the breath of life.

When Miriam (Mary) gave birth to the immortal body of Yahuahshua, it was this "fire" that brought his body to life. This body was the exact representation of the first Adam's body, with one additional aspect. Mated to this body, was the spirit of Yahuah's only begotten Son, Yahuahshua.

Therefore doth my Father love me, because I lay down my life, that I might take it again. No man taketh it from me, but I lay it down of myself. I have power to lay it down, and I have power to take it again. This commandment have I received of my Father. John 10:17-18

Solomon's temple gives us an exact picture of how Yahuahshua, the son of Adam, would take the 2 original stone tablets made by the hand of Yahuah; and (symbolically) make them "come back to life." 
Within this imagery, also comes a grave warning to all believers in Yahuah,  a prophecy that is only now coming to light.
In a manner similar to which our Messiah came, so also the anti-Christ (or Son of Perdition) will come, with one exception.
The body which he creates though medical science and genetic technology, will become
 
The Abomination that causes Desolation.

A depiction of Solomon's Temple


templemount.org


In 70 AD the Roman General Titus destroyed the temple. Yahuahshua prophesied some forty years earlier  that he would rebuild the temple.

"Destroy this temple, and in three days I will raise it up." John 2:19 (NKJ)

The Pharisees and scribes of his day did not understand the significance of this prophecy.

Then the Jews said, "It has taken forty-six years to build this temple, and will You raise it up in three days?"
But He was speaking of the temple of His body. John 2:20-21 (NKJ)

He referred exclusively to the temple of his own body, and by extension the individual body of each believer.

Do you not know that you are the temple of Yhwh and that the Spirit of Yhwh dwells in you? 1 Cor 3:16 (NKJ)


Satan,  the adversary, has his own plan to replicate Yahuah's temple, by building a cloned (or counterfeit body) and then animating it with his unholy spirit.

Shown below is a floor plan of Solomon's temple, based on the description given in 1 Kings Chapter 6;

Pay particular attention to the shape of the temple floor plan.

                 


Notice that there is only one doorway into the temple, and that door faces east. Similarly, it was the eastern gate of the Garden of Eden that was closed off by cherubim with a flaming sword. They did this to guard the way to the tree of life, so no mortal man could enter and eat from the tree. 

Notice the Holocaust or Brasen Altar that stood directly in front of the doorway of the temple This altar of fire, at the east door of the temple, was symbolic of the cherubim with the flaming swords.


Now look at the female reproductive organs:




When you place the female reproductive organs next to the temple floor plan, you can see a certain parallel between the two.

 

The doorway of the Temple aligns with the vagina, and the Holy of Holies is aligned with the womb. Inside the Holy of Holies (or womb) is where the shekinah glory rests and gives light to the room. It is here that only "a perfect" High Priest was allowed to enter. 
It is here, in this same place, that Yahuah's "spark of life" began the fertilization process that brought about the formation of an immortal body.

Therefore, when He (Yahuahshua) came into the world, He said: "Sacrifice and offering You did not desire, but a body You have prepared for Me. Heb 10:5 (NKJ)

Notice the vertical columns, one on each side of the doorway to the temple. Facing the doorway, the one on the left is called "Jachin," or Yakiyn (yaw-keen') in the Hebrew [#3199] and means; "Yaw will establish." The one on the right is called "Boaz," who was the father of Jesse, the father of King David. Are these two columns saying (in a way) "Yaw will establish through Boaz?" Do these two columns, as depicted from their placement, represent two legs?
Even the winding staircase that traversed the three levels inside of Solomon's temple, replicates the design of fallopian tubes from which the ovum descends from the ovaries (as shown in the scripture below);

The door for the middle chamber was in the right side of the house: and they went up with winding stairs into the middle chamber, and out of the middle into the third. IKing 6:8 (KJV)

Any number of priests could enter the inner courts and sanctuary of the temple, but only the High Priest can enter the Holy of Holies.
In like manner, a number of sperm may enter through the door (vagina), but only one will enter the ovum (ark) at fertilization to begin life. That one sperm, like the high priest, must be perfect and without defect. 

Look again at the High Priest's robe.

"
And they made upon the hems of the robe pomegranates of blue, and purple, and scarlet, and twined linen." Exod 39:24 (KJV)



Pomegranates were sewn on all around the hem of his robe.

                                            Now look at an opened pomegranate:

                                                  

There are hundreds of seeds in each pomegranate. All totaled, there were100's of thousands of seeds around the robe of the high Priest. This is a picture of the amount of sperm cells present during procreation. Although the High Priest is symbolically wearing hundreds of thousands of sperm cells around his robe, only he, the High Priest, will be accepted into the ovum.

Even the capitals at the top of each Temple pillar, Jachin and Boaz,  were decorated with 200 pomegranates (each).

On the capitals of both pillars, above the bowl-shaped part next to the network, were the two hundred pomegranates in rows all around. IKing 7:20

Though the number of seeds in the average pomegranate varies by species from between 300-500, let's say for the sake of argument that the 400 pomegranates on the temple pillars contained 360 seeds each for a total of 144,000. seeds. That is the same number used in Revelation 7:4, to describe the total number of the children of Yahuah who are sealed in their foreheads.
Why pick 360 seeds each? It's not an arbitrary number. The earth is a 360 degree circle made of 360 individual arc segments of the same length. Based on ancient calendars, The pre-flood calendar year most likely consisted of 360 (solar) days and a 30 day lunar cycle. 
I believe the number 144,000 indicates the original number of genes, present in the bodies of Adam and Eve, sequenced in a certain way, to establish and sustain immortal life.
It is scientifically understood that the order or sequence of the bases (nucleotides) determines the information available for building and maintaining an organism, similar to the way in which letters of the alphabet appear in a certain order to form words and sentences.
The "words" for the DNA "sentence" are derived from a 4-letter alphabet. Each of the four letters represent the first letter of the four nucleotide bases of DNA.  
They are the letters, "A" for Adenine, "T" for Thymine, "G" for Guanine, and "C" for Cytosine. The order or sequence in which these letters are arranged, are unique to each individual person. So in reality, each individual person has A NUMBER.
I'm not talking about a Social Security Number. I'm talking about your personal genome. It is separate and distinct from all others! This is important to note. We will return to this idea when looking at the mark of the beast; a beast who has "a number" that indicates (or spells) his name, and is also linked to his image. An image that was created by synthesizing a certain genetic code. 

             

Notice that the names of the four bases are abbreviated by the letters, "A,T,G, and C." Your body combines these four letters to spell
your personal and unique sequence. Your's may begin like this:

ATGCTTCGGCAAGACTCAAAAAATA,

and then go on and on, for a  total combination of over 3.1 billion base pairs.

This is the genetic number behind your name. 


The genetic sequence that sustained immortal life was eventually intermingled (becoming lost) within the genetic make up of mankind.

For the Son of man is come to save that which was lost. Matt 18:11 (KJV)

This occurred when Eve was intimate with Nachash, and became pregnant. After which, Eve conceived through Adam her husband, and gave birth to fraternal twins Cain and Abel. Fraternal twins are formed by two separate eggs that are fertilized by two separate sperm.  
In Eve's case, the sperm was from two different men.

Suppose that the original immortal body contained 144,000 genes. Perhaps even the the original DNA strands within each chromosome formed a hexagon, instead of the typical "X" and "Y" shape we know of today. 

(The six sided shape is so prevalent among the scriptures).




 Just like the pomegranates on the High Priest’s robe formed a  hexagon

(Pomegranates are a six sided fruit)

This naturally occurring left handed twist of DNA could be woven in such a manner as to form the shape shown below:

                                     
                                                A weave without beginning or end.

As the DNA is woven around each outside point of the hexagram (shown above) let's say there are 24,000. genes between each point (or outside corner) for a total of 144,000 (shown below). 

                         

This shape is identical to the shape woven into the tunic of a Levite priest. The tunic was woven of linen, to be seamless, using a six ply thread. According to the Jewish Bible scholar Maimonides, this weave produced a "checkered knit" and gave the fabric the appearance of a (six sided) honeycomb pattern.

This was the same type of robe that Mashiyach wore;

Then the soldiers, when they had crucified Yahuahshua took His garments and made four parts, to each soldier a part, and also the tunic. Now the tunic was without seam, woven from the top in one piece. John 19:23 (NKJ)

This robe, covered in honeycomb (hexagons) was an outward sign of his true immortal body.

King David's throne is another picture of DNA, which also points to the strength of the immortal body, and its proprietary construct.

The throne had six steps, and the top of the throne was round at the back; there were armrests on either side of the place of the seat, and two lions stood beside the armrests.
Twelve lions stood there, one on each side of the six steps; nothing like this had been made for any other kingdom. IKing 10:19-20 (NKJ)


Six lions at each side of the six steps, as they extend up to the throne. The lions representing the two strands of the double helix, connected by the base pairs which are represented by the steps. The lions represent the strength of Yahuah who has formed and sustains all life through his DNA. 
David's throne was a picture of Yahuah's throne, which in a real sense, sits at the top of all DNA. 

The six ply thread, the six sided honeycomb pattern of the tunic, the six pointed hyssop leaves, the six pointed Star of David, the six sided pomegranate, and the six steps to the throne, all point to the design of the immortal body. 

"I am the door (portal). If anyone enters by Me, he will be saved (made whole), and will go in and out and find pasture (be fed, or made full). John 10:9 (NKJ)

This doorway (portal) is the door between the two worlds, heaven and earth; the spirit realm and the terrestrial realm.

A picture or likeness of this portal can be found in a tesseract (or fourth dimensional cube). 

                            
We live in a three dimensional world, which can be expressed by mathematical coordinates that can be plotted from left-to right (x); top to bottom (y), and front to back (z); forming a 3D cube. 

However, by adding an additional pair of cardinal directions which is orthogonal to the other three, a fourth coordinate axis is created that is perpendicular to the x, y, and z axes , and is usually labeled "w."

This is a  four dimensional cube shown below:
[ the "w" axis lines have the arrow heads]


                                               

Now, rather than form a cube, continue the "w" axis lines
until they converge at a point (vertex), as in the diagram shown below;
 

                                                  
They form 2 pyramids, each made of four equilateral triangles.

Overlap the two pyramids to form a six pointed star with an interior hexagonal shape. I believe this is the door, portal, or gateway between the dimensions of the physical and spiritual realm.


                           

The tesseract is also another way to interpret the dimensions given of the New Jerusalem, which is usually represented as a cube.

The city was laid out like a square, as long as it was wide. He measured the city with the rod and found it to be 12,000 stadia in length, and as wide and high as it is long. Rev 21:16 (NIV)

Instead of forming a cube, The 12,000 stadia "high" could easily refer to the hypotenuse of the right angle, making this shape a pyramid made of four equilateral triangles.

Why is this shape said to have originated with King David?
I can think of one possible reason. Perhaps David was allowed to pass through this portal on a number of occasions. Such as when King Saul's spear was thrown at him; 

Now the distressing spirit from Yahuah came upon Saul as he sat in his house with his spear in his hand. And David was playing music with his hand.
Then Saul sought to pin David to the wall with the spear, but he slipped away from Saul's presence; and he drove the spear into the wall. So David fled and escaped that night. 1 Sam 19:9-10 (NKJ)

The Hebrew verb being translated as "to slip away" is patar (paw-tar') [#6362] and means to cleave or burst through. "To cleave" means to slice or cut (in two).

Beginning with verse 7 (above) you can see that David was playing his harp while Saul held his spear in his hand. It wasn't until Saul threw the spear that David left the house. I have to ask myself, Was Saul a really bad shot, or did David "split" and then "burst through" (a portal) into another dimension and out of Saul's presence.

[Notice also that David was strumming notes (making vibrations) on his harp.]

This "portal" could be what is called (in Revelation 3:7-10) the "key of David."  A term used specifically to refer the reader back to 1 Samuel.
Just as David had to escape from being murdered by Saul, there is a group of end time believers that will escape the Son of Perdition. 

"And to the angel of the church in Philadelphia write, 'These things says He who is holy, He who is true, "He who has the key of David, He who opens and no one shuts, and shuts and no one opens": "I know your works. See, I have set before you an open door (portal), and no one can shut it; for you have a little strength, have kept My word, and have not denied My name....
"......Because you have kept My command to persevere, I also will keep you from the hour of trial which shall come upon the whole world, to test those who dwell on the earth
(the Tribulation). Rev 3 (NKJ)

All of this is not coincidental. There is a hidden significance behind the hexagon formed by superimposing two equilateral pyramids converging from opposite directions. This may be the reason why before Noah's flood, the Nephillim (or Gibborim) used the same shape when building the pyramids at Giza. Perhaps they were trying to duplicate something on earth, that exists in the spirit realm, to escape what was about to befall them in the physical realm (Noah's flood). 

The six pointed star, as I pointed out earlier, also relates to the shape of the Hyssop tree leaves 
(Fig 2). 
This same shape can be made by plotting the 6 individual grid coordinates it takes to locate a single place in 3 dimensional space, 
[shown in Fig 1 below]; 


Fig. 1

Fig. 2

Or for that matter, to locate a single place on earth from any point in the galaxy.

The six points that locate the door to the paradise of Yahuah, could be located directly over Jerusalem. Or more precisely, rest over the equilateral triangle formed by connecting Mount Moriah with Mount Zion, and then with the Mount of Olives.

             

Consider the name "Jerusalem" in its archaic form, "Yaw-roo-shaw-lam'"

#3389 Yeruwshalaim (yer-oo-shaw-lah'-im); a dual [meaning this is a compound word formed from combining two separate words.] probably from (the passive participle of) 3384 and 7999.

#3384 yarah (yaw-raw'); a primitive (or archaic) root; properly, to flow as water, figuratively, to point out (as if by aiming the finger), to teach: 

#7999 shalam (shaw-lam'); a primitive (or archaic) root; to be safe (in mind, body or estate); figuratively, to be completed. 

Look again at the triangle above. Is this the location of the Garden of Eden, the place where the river of the "waters of life" proceed forth? The same place where the tree of life is centered, that was closed off from the physical realm because of sin. 
The ancient name for this city can be interpreted as, "made complete by the flowing water." 
This meaning also reveals a future reality for all those who will drink from the river of life. 


Side note: I consider the pyramids located all over the world, as well as the Sphinx,  the Stonehenge, and the Easter Island Giants, to be nothing more than colossal headstones meant to survive the destruction of the flood, and to serve as a burial marker for the last of the Nephilim giants. 
According to the scriptures, at the time when Yahuah first decided to destroy the earth and its inhabitants (except for Noah and his family) a 120 year reprieve was granted;

And Yahuah said, "My Spirit shall not strive with man forever, for he is indeed flesh; yet his days shall be one hundred and twenty years." Gen 6:3 (NKJ)

During which time Noah builds the ark and the Gibborim (the children of the Nephilim) are put on notice that they have 120 years left to live. They built these monuments, whose remnants are seen on the earth today, to mark their graves. I can only think of one reason why - to preserve their DNA. So that one day in the future, when the technology became available, their kind could be resurrected. 
That day is now.

The prophecy of Revelation 17 foretells of a beast with seven heads, who are also seven Kings. 
This beast has one distinct attribute. He existed in the natural world at some point in the past, and will live again;

"The beast that you saw was (once alive), and is not (presently living) and will ascend out of the bottomless pit and go to perdition." Rev 17:8

This beast will be resurrected,

" And those who dwell on the earth will marvel, whose names are not written in the Book of Life from the foundation of the world, when they see the beast that was, and is not, and yet is." Rev 17:8

The seven heads of the Beast, represent seven hills and also seven kings;

"This calls for a mind with wisdom. The seven heads are seven hills on which the woman sits. They are also seven kings. Five have fallen, one is, the other has not yet come; but when he does come, he must remain for a little while.
The beast who once was, and now is not, is an eighth king. He belongs to the seven and is going to his destruction. Rev 17:9-11 (NIV)


The angel is telling John the Apostle that at the time this prophecy is given, five of the seven Kings he is referring to are dead. The sixth one is presently alive and reigning as a King. The seventh King has not yet come but when he does, his reign will be brief. Then the eighth King will come into power. 
There are two ways to interpret this prophecy. The angel tells John that at the time of this saying, five kings have fallen, and one "is." The king who "is," is most likely the Roman Emperor who is ruling at the time of John's exile. That means the seven Kings are to be interpreted as world empires rather smaller kingdoms.
I count Satan's first born son Cain, who built the first city,  to be the beginning of the first world empire (which was destroyed in the flood). 

And Cain knew his wife, and she conceived and bore Enoch. And he built a city, and called the name of the city after the name of his son-- Enoch. Gen 4:17 (NKJ)

After which comes Nimrod;

"
...Cush begat Nimrod: he began to be a mighty one (gibbor) in the earth." Gen 10:8 (KJV)

"And the beginning of his kingdom was Babel,..." Gen 10:10 (KJV)


Babel becomes the second world empire, until Yahuah scatters the people over the face of the earth (Gen 11:8) Afterwards, it is reorganized under King Nebuchadnezzar and becomes Babylon, the most powerful world empire of its day. It is at this time the prophet Daniel interprets the dream Nebuchadnezzar had of world empires (including his own). In this dream the King sees an image with a head of gold, a chest and arms made of silver; a bronze stomach and thighs, with legs of iron, and feet made of iron and clay. Daniel tells the King that he is the head of Gold, and that each kingdom to arise after his will be inferior to his. 
If one agrees with the generally accepted identity of the world empires, Babylon (the head of gold) falls to the Medes and Persians, who are represented by the chest and arms of silver. Who in turn are conquered by the Greeks (the stomach and thighs of bronze), who are conquered by the Romans (the legs of iron).
If you place the world empires of Cain and Nimrod ahead of Nebuchadnezzar's Babylon; they would be numbered like this;

1.  Cain
2.  Nimrod
3.  Babylon ( Nebuchadnezzar)
4.  Medes/Persians (Darius)
5.  Greeks (Alexander the Great)
6. Roman (Caesar Augustus, 1st Emperor of Rome, 27 B.C.)

This could put the prophecy told to John the Revelator (Rev 17:9-11) in this perspective;

Five have fallen, (Cain, Nimrod, Babylon, Medes/Persians, and Greeks)
one is,
(Rome, at the time when the Book of Revelation was written)
the other has not yet come; but when he does come, he must remain for a little while.

According to DaniUl's interpretation of the image in Nebuchadnezzar's dream, the next (or 7th) Kingdom to come has the "feet of iron and clay." While referring to this kingdom, DaniUl says to Nebuchadnezzar;

And whereas thou sawest iron mixed with miry clay, they shall mingle themselves with the seed of men: but they shall not cleave one to another, even as iron is not mixed with clay. Dan 2:43 (KJV)

Iron is not made man, it is a naturally occurring element. Iron is being used here to refer to a group of lower angels (who should be represented by gold) but they sinned when they left their first estate (the spirit realm) and went after strange flesh (the daughters of men in Genesis 6)
DaniUL says right here, that angels will once again "mingle themselves with the seed of men." Since Jude says the original fallen angels;

"....He has reserved in everlasting chains under darkness for the judgment of the great day; Jude 1:6 (NKJ)

DaniUl could be referring to a demonically inspired plan being implemented through modern medical technology; to bring about the same net result achieved "in person" by the original fallen angels.

Notice that the 7th king remains (or continues) for a little while (a short space of time) and then is replaced by the 8th and final king. The 8th King is the scarlet colored beast of Rev 17:3. The beast whom the woman rode that was drunk with the blood of the Saints. The seven earlier kings ruled over a geographic segment of this world, but the 8th king rules over the entire world! He is the Son of Perdition.

Since Revelation 17:9 begins by saying "this calls for a mind with wisdom," the full meaning may not be apparent until it becomes relevant. The eighth King could be an individual living in the end times, who was previously a world ruler. Someone who has been "brought back to life" through bio-technology (or cloning). It is possible that under one of the world's colossal headstones (like the Sphinx) a burial chamber has been found that contains  the remains of a Gibborim. Remains that have enough DNA to "resurrect" him who was buried there (with a little help from modern science).
It could even be the remains of the world's first ruler, Cain. 
Or, the first Son of Perdition, Judas Iscariot.

I say this because I've often wondered about the curious nature of this scripture verse;

But even the archangel Michael, when he was disputing with the devil about the body of Moses,...." Jude 1:9 (NIV)

Why did Satan want the body of Moses? Was he looking down the road to a time when he could use his DNA?

How about Judas, is he coming back? Since he was the first Son of Perdition, is he the one to be resurrected as the anti-Christ or last Son of Perdition? 
Consider this scripture verse which contains a curious statement:

[Matthias takes Judas Iscariot's place] "That he may take part of this ministry and apostleship, from which Judas by transgression fell, that he might go to his own place." Acts 1:25 (KJV)

What does that mean exactly, "that he might go to his own place?" Did he not go to death, the grave or Hades (which are the usual locations mentioned)?
In NT Greek, the words are translated as;

he might go -   4198 poreuomai, to traverse, i.e. travel (KJV-depart, go)

to -1519 eis (ice); a primary preposition; to or into (indicating the point reached or entered), of place, time, or (figuratively) purpose. 

his own - 2398 idios (id'-ee-os); of uncertain affinity; pertaining toself, i.e. one's own; by implication, private or separate: 

place - 5117 topos (top'-os); apparently a primary word; a spot (general in space, but limited by occupancy; whereas {in contrast} 5561 is a large but participle locality), i.e. location (as a position, home, tract, etc.); figuratively, condition, opportunity.

So then, did Judas Iscariot travel to his own "separate spot?"  Maybe to be recalled later? I can only speculate at this point.


The Sphinx itself could be a harbinge
r of the end times. It is most surely a pre-flood monument. It is the statue of a Lion that has had the disproportionate head of a Pharaoh carved in at some later time.
Coincidentally, the Sphinx faces east towards Solomon's temple, but I think not in anticipation of the arrival of the first Messiah. More likely he is looking forward to the birth of the Son of Perdition.


The 144,000

"Do not harm the land or the sea or the trees until we put a seal on the foreheads of the servants of our Yahuah." Then I heard the number of those who were sealed: 144,000 from all the tribes of Israel. Rev 7:3-4 (NIV)

This reference to 144,000. persons from all tribes, means more than just 144,000 individuals. It refers to the 144,000 genes which makes up the House of Israel; 12,000 genes from each of the 12 tribes. These 144,000 genes are the "virgins" referred to in Revelation chapter 14, that have never been corrupted and have remained pure in their original form. They may have been mingled with the genes of mankind, but they were not individually broken down and their proprietary DNA sequencing remains individually intact. 

And I heard a voice from heaven, like the voice of many waters, and like the voice of loud thunder. And I heard the sound of harpists playing their harps.
They sang as it were a new song before the throne, before the four living creatures, and the elders; and no one could learn that song except the hundred and forty-four thousand who were redeemed from the earth.
These are the ones who were not defiled with women, for they are virgins. These are the ones who follow the Lamb.. Rev 14:2-4 (NKJ)


Only the immortal life genes will be capable of responding to the "new song," made from the new vibrations, formed by the two notes missing. 
We know that all atoms exist in a state of vibration; these new vibrations will create a frequency, known only to Yahuah, that will bring about the eternal body. 
Since the Greek word referred to here as "virgin" means maiden or unmarried women; how else can this be interpreted? Are we to understand this verse to mean that all of the 144,000 present with Yahuahshua on Mount Zion are unmarried women who have not been defiled with other women? How does that make sense? Or does it mean that since the time of Eve, these 144,000 genes have never been defiled or polluted.
We have learned through modern biology exactly what occurs in the ovum during human reproduction.  We know for certain that the integrity of the original gene pool from Eve has never been defiled. This is not conjecture, I'm speaking with certainty of undisputed scientific fact.
After the female egg (ovum) is fertilized, and begins to multiply; a certain number of cells which are all alike, form what is known as the "germ cells." Earlier biologist referred to this collection of germ cells as the germ plasm. Either way, it means the same thing.
Upon further division of these cells, a change takes place in the chemical composition of the cells, which signals the emergence of "body cells." These body cells will eventually form an entire human body. However, the most intriguing thing is, the rest of the original cells preserve their character as germ cells. So, what is now present inside of the ovum, separated into two distinct groups, are germ cells and body cells. It is the germ cells (or germ plasm) that will be passed onto the next generation. At this stage of the babys development, the mass of cells is called a blastocyst. Soon a reproduction system will begin to form. The blastocyst will eventually collapse in on itself to form a genital ridge. Once this happens, gonads will form in the genital ridge. The germ cells, which have kept themselves separated from the body cells, will now migrate via the vascular system, and invade the gonads. The germ cells will not come into contact with blood. Depending upon whether the developing baby is male or female; the gonads will develop as either testes or ovaries. At which time, certain hormones will be secreted  to form the appropriate organs and external genitalia. If this baby is a female, the germ cells will become the "oocytes" (or eggs) that will be produced during the fertile period of this woman's life. In other words, the original germ cells that began the this entire process of creating a new body; will stay inside the ovaries that are now forming, and become the new "oocytes." 
Biologist August Weisman first noted the important distinction to be made between germ cells and body cells;

Body cells are made from the germ plasm, the germ plasm is not made from body cells. 

He called this theory the "Continuity of the Germ Plasm."
Biologist Arthur Custance once wrote (thinking in purely biological terms); "creating a woman is merely the ovum's way of creating another ovum." While it might seem disconcerting to think of the body mainly as a mechanism for passing down the germ plasm (to the next generation);  the fact is, this is exactly what has occurred.  The germ plasma has always kept its integrity intact, by staying isolated from the body cells. It has been kept in its original immortal form,  passed down from the first woman Eve, in an unbroken chain, through generations of women until it reached Mary, the mother of Messiah.,  The germ plasm itself,  has never inherited the mortogenic (or death) factor. 
The germ cells are immortal. 

On February 10, 2010, Life Extension Magazine published an article entitled, "Immortal Stem Cells for Anti-Aging Therapies."  They Interviewed Michael D. West, PhD, CEO of BioTime, Inc., about a new breakthrough published in the journal Regenerative Medicine. The paper reported,

" the reversal of what Dr. West has called the "developmental aging" of adult human cells in the laboratory dish. Utilizing genes that grant our reproductive cells the potential for immortal growth, the researchers showed that it was possible to turn back the clock in human body cells, enabling the potential for young patient-specific cells of any kind for use in regenerative medicine.

[This research was funded in part by the Life Extension Foundation®]

Just as August Weisman pointed out, a fertilized ovum forms a group of germ cells, which in turn causes the production of body cells. There is a certain group of body cells known as stem cells, which can regenerate tissue function, but only for a short period of time.

As Dr. West explains; "...in the case of humans, adult stem cells all appear to be mortal."
So, the idea behind "turning back the clock in human body cells" is to return them to their previous state as germ cells. He goes on to say;

"The problem with human biology is that the immortal reproductive cells that built you and me develop into differentiated cells within our bodies and as a result, lose the capacity to proliferate (divide) forever. So, the cells of the body are mortal, meaning they have a finite life span, and as our tissues age, or deteriorate from disease, our body has a finite capacity to regenerate and repair those tissues. As a result, we suffer progressive declines in function that lead to our death.
The goal of gerontology for many years has been to find the reason that our reproductive lineage continues to make babies generation after generation while the other cells in our body, called somatic cells, have a finite life span and are mortal, or, in other words, to discover the reason babies are born young. The answer is that we come from a lineage of cells that have been proliferating since the dawn of life on earth. The cells that made us have no dead ancestors.
So, the goal has been to discover a way of transferring the immortality of reproductive cells into the body in order to increase the potential life span of individual human beings
If we can learn the lessons of how our reproductive lineage has been creating babies for millions of years to continue the human species, we should be able to design medical therapies to allow the human body to regenerate itself and escape the genetic boundaries of human life."


Dr. West confirms the scientific fact behind our origin as a species, we come from immortality. Or, as he put it, "the (germ) cells that made us have no dead ancestors."
Herein lies the hope of mortal man in the simplest of terms, " we should be able to design "medical therapies" to "escape the genetic boundaries of human life."


This medical therapy will become known as the "Immortal Life Therapy."


Now to Abraham and his Seed were the promises made. He does not say, "And to seeds (synthetic or otherwise)," as of many, but as of one, "And to your Seed," who is Christ. Gal 3:16 (NKJ)

The final abomination of desolation spoken of by Mashiyach in Matthew 24 refers to a  genetically engineered creature who is immortal. Bio-engineers will create a back door to immortal life, which will appear to be a gift from "God." 

Ever since the first sin, the penalty for sin has been death; to be cut off from the tree of life with no chance to inherit eternal life (outside of the redemptive work of Yahuahshua). The immortal life therapy will cancel out the penalty for sin. By doing so, it will render the work of Messiah to be of no effect.
In the kingdom of anti-Christ, there will be no need for a Messiah or Redeemer. Immortal life will be obtained by our New Age god, the god of Medical Science. 

Those who do not belong to Yahuah, and do not seek His truth, will accept this offer. They will be lead to believe it has the power to deliver them from death. For the unbeliever, the true and hidden desire behind taking this therapy lies in the hope that they will never have to meet their Creator. 
Those who have been sealed with the mark of YHWH, will reject this offer and all others that attempt to make them deny their faith.

The offer of immortal life, will lead to the "falling away" spoken of in Thess 2. The term "falling away," which means a "defection from truth," was never intended to describe a slow decline in faith that would take place over an extended period of time. For example, the decline of a spirit filled church into a lukewarm church. Or in a greater sense, the worldwide decline of Christendom into a state of global Humanism. The falling away referred to here will be relatively quick, occurring over a short period of time. This will happen when those who profess to believe in Yahuahshua the Messiah, will drop their so-called "faith" to embrace the anti-Christ's immortal life therapy. This is all it will take to separate the sheep from the goats. It will become evident who belongs to Yahuah, and who belong to Satan.  

When Yahuahshua spoke to the Pharisees, He made a distinction between two different types of people; those who were Abraham's descendants (only) and those who were his children (by faith).

I know you are Abraham's descendants (seed). Yet you are ready to kill me, because you have no room for my word. I am telling you what I have seen in the Father's (Yhwh) presence, and you do what you have heard from your father (Satan)." "Abraham is our father," they answered. "If you were Abraham's children ," said Yhwhshua, "then you would do the things Abraham did. John 8:37-39 (NIV)

The children will believe by faith, eternal life comes from the Father. We must always be mindful that although we walk through the valley of the shadow of death, it is only its shadow. We will never see death.

-break-

The Coming Kingdom of anti-Christ.

"Let no man deceive you by any means; for that day shall not come except there come a falling away first, and that man of sin be revealed, the son of perdition." — 2 Thess. 2:3.

It is not coincidental that Yahuahshua used the term  "son of perdition" when describing Judas Iscariot. This must point to a certain parallel between Judas Iscariot and the end times Son of Perdition. 
Who was Judas? We know that at the beginning of his ministry Yahuahshua selected twelve disciples; eleven men from Galilee, and one from Judah. The one from Judah (Judas Iscariot) is the one who betrayed him. There has been much speculation as to the motives behind this betrayal, but one stands out in particular. It is apparent from the New Testament scriptures that Yahuahshua was a Nazarene. I don't mean that he was a person from the town of Nazareth. According to the Old Testament the town of Nazareth did not exist. He was a person who took a Nazarite vow, according to the Old Testament custom. The Nazarenes were a sect within Abrahamic Hebraism who believed in and lived the "10 Words," the true Torah. They rejected Pharisaic Hebraism which promoted the oral traditions and ordinances of the Babylonian Talmud. 
There were seventy members which comprised the Hebrew Court called the Sanhedrin. They were the established religious power of that day, and the Pharisees were a majority in that Court.
In my opinion, Judas was most likely an agent for the Sanhedrin, sent in to infiltrate the Nazareans, who they saw as a group that could overturn their rule. Also at play here is the matter I brought up earlier regarding the natural birth of Yahuahshua, as oppossed to the Virgin Birth Doctrine. The issue at stake before the Sanhedrin is not just how to silence a renegade preacher of a low social status, but how to get rid of someone who has a legitimate claim to the throne of Judea. Christian theologians, past and present, teach that Yahuahshua came to claim a spiritual kingdom that exists in the heavenly realm - and that is all. This doesn't carry any weight with me anymore.
I can't help but wonder what would happen if by some strange circumstances, I was able to address The Parliament of Great Britain; and with the Queen in attendance, announce to them that I was the King of England, me - Bill Kinney! But...... only in the heavenly realm. And once each loyal British subject has died and ascended to my Kingdom, I will rule over them as King. If you've ever watched the British Parliament on C-Span, you can guess what would happen next. The boos and hisses would be drowned out only by the sound of laughter. On the other hand, what if I was the unknown but legitimate son of Princess Diana, and I was hid away because of death threats made by certain people who had assassinated my mother. That would change things. 
I think the threat to the Sanhedrin was Political and had ramifications in this life and not just the life to come. The Sanhedrin ruthlessly hounded the Yahuahshua until they were finally able to murder him! And it was Judas that lead them straight to him!

The Son of Perdition will be like Judas who appeared to be a friend to Christ and His church. So much so, that none of the other disciples, even during the Last Supper, ever suspected him of being a traitor. When Yahuahshua said to them; 

"....Verily I say unto you, that one of you shall betray me.

The disciples;

"....were exceeding sorrowful, and began every one of them to say unto him, Raboni, is it I? Matt 26:21-22 (KJV)

They didn't have a clue.

Then Satan entered Judas, surnamed Iscariot, who was numbered among the twelve. Luke 22:3 (NKJ)

In the end, Judas betrayed him with a kiss, under a false pretense of honoring him. 
In like manner, the Son of Perdition will be loved by the people on earth because he honors Christ; who some call the Son of God, and others call a great prophet.
In the same way that Satan used Judas to betray Yahuahshua; Satan will again use the end times son of perdition (who is the end times Beast) to betray those who say they are the people of "God." Just as the disciples were unaware (perhaps even deluded) as to the true nature of Judas Iscariot, so the end times Church will not only worship the beast, but also the one who has empowered him.

When the wicked one is revealed, whose coming is after the working of Satan, with all sorts of unrighteous deception;

"...Yhwh shall send them strong delusion, that they should believe a lie:... II Th 2:11 (KJV)

Notice that the delusion is "sent" from Yahuah. This "strong delusion" will be much more than a mere man walking into Solomon's rebuilt stone temple and declaring himself to be "God."  
 The scriptures say that he will prove himself to be "God!"

"Let no man deceive you by any means: for that day shall not come, except there come a falling away first, and that man of sin be revealed, the son of perdition; Who opposeth and exalteth himself above all that is called Yhwh, or that is worshipped; so that he as Yhwh sitteth in the temple of Yhwh, shewing himself that he is Yhwh. II Th 2:3-4

Look at a break down of the original Greek word meanings of 2Th 2:2, it reveals the truth;

so that he [ a reflexive pronoun]
as God ["theos," a deity]
sitteth ["kathiz," to seat down, to sit, to settle (hover, dwell)].
in the temple ["naos," to dwell; a fane, shrine, temple].
of God, ["theos," a deity]
shewing ["apodeiknumi," to show off, exhibit; to demonstrate.
himself [ a reflexive pronoun]
that he is ["eimi," emphatic, I exist (as)]
God ["theos," a deity]

The important distinction made here (in the wording) between the Son of Perdition and those who merely claim to be "a god" (like Antioch Epiphanies) is that the Son of Perdition will show everyone that "he exists as a deity." He will not only say these words, but he will demonstrate it to the world, "I exist as God."
How can someone prove they are a deity, or even the Creator? There can be only one answer, he will be immortal. And just as Yahuah can give immortal life, the anti-Christ will be able to impart this immortality to others, through his scientific miracle.
Those whose names are not written in the Book of Life, will worship him for this achievement and his ability. 

This is Satan’s Genesis temptation presented all over again:

".... in the day ye eat thereof, then your eyes shall be opened, and ye shall be as gods,...Gen 3:5

In other words, if you partake (eat) of this fruit (a genetically altering drug therapy) you will become immortal. Make no mistake, this therapy will not impart the eternal and self existent life that only Yahuah can give. However, the full nature of the limitations of this therapy will not be generally known among the people.
Through genetic engineering (and Bio-Chemistry) scientists have most likely already discovered the correct gene sequencing that produces an immortal body. By cloning a body with this sequence, scientists will be able to "manufacture" a soul-less creature ready to be inhabited by a demonic spirit. It will not have a spirit sent from Yahuah, who is "the Father of spirits." This illusion with its phantom persona, is an abomination. 
Once a person begins the gene therapy treatments, they will become dependent upon drugs and a therapy that can't be stopped. As I mentioned before,  this therapy will even begin to noticeable reverse the aging process, making those who use the drug (therapy) look and feel younger. It may even improve intellect, perception, especially spiritual perception (in an evil sense) by allowing the recipients to see into the spirit realm. They may even be able to see the demonic beings who have befriended them, but will later torture them without mercy.

It is commonly taught in Christian eschatology that the rebuilding of the temple is the primary indicator that we are in the tribulation. Some even say that the son of perdition will include a provision to rebuild Solomon's stone temple as part of his Middle East peace plan (or treaty). But where in the scriptures does it say that he will rebuild Solomon's temple? It does say however, 

And he [the Son of Perdition] shall plant the tabernacles of his palace between the seas in the glorious holy mountain; yet he shall come to his end, and none shall help him. Dan 11:45 (KJV)

Notice it says "his" tabernacle shall be planted between the Dead Sea and the Mediterranean Sea, in the glorious holy mountain. This reference to the "glorious holy mountain could mean Mount Zion instead of Mount Moriah (Mount Moriah being the place where Solomon's temple once stood). Either way, this scripture says that the son of perdition will build "his palace" and not Solomon's temple.
Theologians say that since it is prophesied that he (the anti-Christ) will take away the daily animal sacrifice, then the temple must be rebuilt, in order for there to be a sacrifice. The fact is, in DaniUl 12:11 the word "sacrifice" has been inserted by the translators to help in the interpretation. This was done because of a lack of understanding. What DaniUl 12:11 actually says is; the anti-Messiah will remove that "which is continual." I'll explain this in full momentarily, but for now, that "which is continual" is nothing less than Yahuah's eternal life. Instead of thinking in terms of rebuilding Solomon’s stone temple, consider instead that Satan has used biology to duplicate "that which is continual." He has a plan to desecrate Yahuah's image by manufacturing a counterfeit body that is immortal
This will signal the start of the tribulation. When this is revealed, look for the two witnesses that stand before the Ul of the earth to appear and denounce this therapy.

Remember that part of the delusion suffered by the apostate Church is to not recognize its own condition, that it is indeed, apostate. It has deserted its first love, Yahuah, who alone gives the gift of eternal life. They have deserted him by putting their faith in a medical therapy that replicates "that which is continual."

My sheep hear my voice, and I know them, and they follow me:
And I give unto them eternal life; and they shall never perish, neither shall any man pluck them out of my hand. John 10:27-28 (KJV)

This is the remarkable and unique nature behind the "strong delusion." It will bring everyone in the world to the same place, at the same time; to a moment of decision, when all will be compelled to make a choice;

Do I believe in the life after death offered by Yahuahshua, who almost 2000 years ago said He was the Messiah? Or do I accept the immortal life therapy being offered to me now, and never see death?
Can you hear the "spiritual leaders" of the world rationalizing among themselves? Praising the good intentions of Dr. Newman (the anti-Christ's chief medical officer)) and his gift that will make you a
"new man."
After all, isn't that what the scriptures tell us to; 

:....put on the new man which was created according to Yahuah, in true righteousness and holiness." Eph 4:22-24 (NKJ)

So too will the Son of Perdition offer you a new life.

Pastors, Preachers, Rabbi's and teachers; will all give compelling testimonies about how "This therapy is doing so much good, it could only come from God!"

You can imagine the slick advertising that big Pharma will put on TV.  Carefully selected scenes of children that were diseased and deformed; hurt and injured, being miraculously healed. Video images on the six o'clock news of a child killed in an accident being brought back to life. Imagine never having to get sick. Imagine never having to die! How could any parent deny their child the right to live healthy, and to live forever. Simply put, they won't be able to!  In fact, look at how individual States have taken a more prominent and forceful role in asserting their rights over parental rights in the last 30 years. Once this therapy is available, it will become the law of the land, and part of the United Nations "Children's Bill of Rights." Parents will not have a choice but to administer this to their children. If you refuse, get ready to hide your children, you will all be fugitives from justice.


There is some speculation as to whether the Son of Perdition will be a Hebrew or a gentile. Varying opinions are usually based in part upon how you interpret these scripture verses:

"He shall regard neither the God of his fathers nor the desire of women, nor regard any god; for he shall exalt himself above them all.
"But in their place he shall honor a god of fortresses; and a god which his fathers did not know he shall honor with gold and silver, with precious stones and pleasant things. Dan 11:37-38 (NKJ)


Some scholars translate "Elohim" as the "God" of his fathers,
while others translate it as the "gods" of his fathers. The God of his fathers would indicate he is a Hebrew, since this reference to Yhwh in the singular-plural would indicate the one true Creator as revealed in the Hebraic faith.
While the term gods of his fathers would indicate his fathers were polytheistic and he is probably an Assyrian or Babylonian. The main point is, His "God" will be a new god that his father (or fathers) did not know. This god is the god of medical science. 
The Son of Perdition himself, will be a marvel of modern genetics. I can see him fulfilling the prophecy
in Daniel 11, by being  "the androgynous one," both male and female.  

"[n
or shall he regard] the desire of women."

This saying is
usually interpreted to mean that he is a homosexual man, because he does not desire woman. Instead, I think it means he is a "he/she," or an androgynous one, biologically engineered to fulfill the long time goal of the secret society of the Illuminati. Their desire has always been to correct what they consider (in their theology) to be the Creator's mistake. They want to bring man back to the place in time, when he was just "Adam" in the Garden of Eden, before Eve was brought out from him as a distinct person. They view the separation of Eve from Adam as an error which lead to the beginning of sin. If ever there were a time in history when it was possible for the Illuminati to fulfill their goal, it is now. 
I have no doubt that the people will marvel at the immortal androgynous one, who by means of  biotechnology will offer mankind immortal life. 

You may be asking yourself, will anyone really believe this? I refer you to the scriptures for the answer to that question. Do not overlook the most important aspect of end time prophecy, and it is not the number 666. The primary indicator that we are in the last days is that the people of the world already worship the Beast - at his appearing. There is no question as to whether or not they will believe it. They've been "prepped" to expect it, and they marvel at his appearing! It is wonderful! It is a beautiful delusion and not to be feared but rather enjoyed. Just as the angels appeared to the shepherds and announced the birth of the true Messiah; you can be sure the appearing of the son of perdition will be accompanied by an "angelic" announcement, and other compelling skyward apparitions. 

But why the he/she, is that really possible?

In October of 2009, scientists at Stanford University announced they were able to coax human embryonic stem cells to turn into the types of cells (germ cells) that make eggs and sperm. This research makes possible the making of sperm cells from female cells. 

Is this what Yahuah alludes to in Jeremiah 31:21-22, when he is looking forward in time, just before the day when Ephraim will return from his exile in foreign lands to the land of Israel, when he will create a new thing?

How long will you gad about, O you backsliding daughter [the House of Israel]? For Yhwh (Yahuah) has created a new thing in the earth-- a woman shall encompass a man." Jer 31:22 (NKJ)

The translation of the phrase, "a woman shall encompass a man" is somewhat outdated. The 17th Century translators didn't know what to make of the meaning behind several of the Hebrew words used in the phrase. 
For example, the word translated as "encompass," or "cabab" in the Hebrew [#5437] means to revolve, turn about, or "change." So the phrase can read, " a woman shall change into a man." Some may consider this to be taken out of context, but the rest of the translation actually supports this idea.

Yahuah has created a new thing in the earth; 

a female  [neqebah, #5347] meaning the "female" form of mankind. This term is different from the Hebrew word " ishshah" which means a "woman" (in general).

shall change into

a man. [gheh'-ber, #1397 ; meaning a valiant (or mighty) man or warrior. This is from the same word used to describe the "men of renown," the children that the fallen angels conceived by raping the daughters of men.

There is nothing new behind the phrase, "a woman shall encompass a man" since this is what naturally occurs during every pregnancy. But a "geber" of a "ghibor" has not been created since Yahuah locked away the fallen angels, as described in Jude's epistle;


"...the angels which kept not their first estate, but left their own habitation, he hath reserved in everlasting chains under darkness unto the judgment of the great day. Jude 1:6 (KJV)

This prophecy is meant to alert us to the reappearance of the Gibborim!


The "God" which the anti-Christ worships that his father did not know (Dan 11:38) is called  the "God of forces:" [as translated in the original King James Version].

Look at the original Hebrew definition of the word translated as "fortresses or forces;"

ma` owz [#4581] from 5810; a fortified place; figuratively, a defense: and translated at other places in the KJV Bible as -- force, fort (-ress), rock, strength (-en), strong (hold).

it is derived from the root word:

`azaz [#5810] a primitive root; to be stout (literally or figuratively): and translated at other places in the KJV Bible -- harden, impudent, prevail, strengthen (self), be strong.

Of the 37 times ma'owz appears in the scriptures, it is mostly used to describe the physical attribute of strength and power; rather than its figurative meaning of a defense (or fort).

"Uz" by itself (as a word) means strength. 

`uwz [#5756] a primitive root; to be strong; causatively, to stregthen; 

and `Uzziy [#5813] means forceful.

There are a number of biblical proper names that incorporate "ooz" and "az" to indicate strength, power, and force, from Yahuah (shown below); 

"Uzziul" (ooz-zee-ool) [#5816] means "power of Ul, The Mighty One." ( Ex 6:18, Numbers 3:19, 1 Chr 4:42, Neh 11:22)

`Uzziyah (ooz-zee-yaw') [#5818]; or Uzziyahuw (ooz-zee-yaw'-hoo); "strength of Yaw." 

`Azazyahuw (az-az-yaw'-hoo);#5812 from 5810 and 3050; Yaw has strengthened.

Could this new "god" whom his father did not know, be one which can impart immortal life, by using a power or
force which can make one stout, or as strong as a fortress - even prevail over death? A power that originates in the correct genetic code that produces immortal life? The same sequence which Yahuah used in the Garden of Eden to create Adam and his wife?
The discovery and use of such knowledge would enable mankind to make himself a "god," (seemingly) independent from Yahuah's sustaining power of life. This is exactly what is spoken of in Psalm 2, shown below;

[Hebrew words and translations in brackets]:

Why do the heathen [nations] rage, and the people imagine [plot] a vain thing?
The kings of the earth set themselves [stand together], and the rulers take counsel together, against Yhwh Ul (Yahuah our Mighty One), and against his anointed [Messiah], saying,

[Take special notice here of this saying. This is a time unlike any other time in the history of the world. As these verses point out, all of the nations of the earth have devised a scheme to come against the Creator and His Messiah. This has never been done before in the history of the world, neither will it ever be done again]

Let us break [ tear off, root out] 
their bands
[bonds, chains]  asunder, and 
cast away
[pluck out, throw down] 
their cords
[something intwined, cord, rope, wreath, interlace] 
from us.


The nations of the earth have plotted to "break off their bands," and tear down the chains that bind them.
The Hebrew words used for "their bands" is "mowcer" (mo-sare') [#4147] and means chastisement and restraint. What is the chastisement and the restraint placed upon all men by our Creator? It is death. The kings of the earth are going to break the chastisement of death imposed by Yahuah, and come against the Messiah of Yahuah by stealing away his right to grant eternal life. This is what is meant by "throwing down their cords." 
The Hebrew word used for "cords" is `aboth (ab-oth') [#5688] and means, something intwined, a string, or wreath. 

This is a picture of the cords of life itself, the double helix of DNA.  

The plan which the Rulers plot in vain, is their plan to synthesize immortal life, apart from Him who alone sustains all life.

He that sitteth in the heavens shall laugh: Yahuah shall have them in derision.
Then shall he speak unto them in his wrath, and vex them in his sore displeasure.

The answer to this bold but unholy plan to usurp Yahuah's place as Creator, culminates in the "Day of Yahuah," which is the end times "Day of His Wrath."


How much will the people on earth pay to receive this "immortal life?"

He [the Son of Perdition] shall... honour [this god] with gold, and silver, and with precious stones, and pleasant things. Dan 11:38

The sum of money that will be obtained from the worldwide sales and distribution of "immortal life" will be unfathomable. The Book of Revelation gives us a clue;

And the light of a candle shall shine no more at all in thee; and the voice of the bridegroom and of the bride shall be heard no more at all in thee:
for thy merchants
[tradesman]
were the great men [3176 megistos (meg'-is-tos); the greatest or very great:]
of the earth
[world];
for by thy sorceries
[5331 pharmakeia (far-mak-i'-ah); from 5332; medication ("pharmacy"), i.e. (by extension) magic (literally or figuratively): sorcery, witchcraft, a drug, spell-giving potion); a druggist ("pharmacist") or poisoner, and (by extension) a magician or sorcerer.
were all nations deceived. Rev 18:23 (KJV)

The word "sorceries" being derived from the Greek word, "pharmakeia" is  where we get our English word for Pharmacy and Pharmaceuticals.

The "pharmakeia" spoken of here is the drug therapy that will be peddled as "immortal life."  
It is not coincidental,  that the words spoken to Eve in the Garden of Eden;

"....ye shall be as gods,..." Gen 3:5 (KJV)

were spoken by a man whose Hebrew name, just like the Greek word "pharmakeia," has its origin in the words; magic, spell caster, witchcraft, and sorcery. That man's name in the Hebrew is Nachash.
The "tempter" from in the beginning, will be the same "tempter" in the very end.

You can be sure this drug therapy will have a nice catchy name that makes everyone feel good about using it.

Maybe something like, 

THE Immortal Life Therapy. 
"He Lifts." A nice little anagram for,  He (God) Lifts Us Up.

or how about this one;

The immOrTAL LIFE therapy
"TOTAL LIFE."

(This one gets my vote).


How could people fall for such a thing? It is because they already worship the son of perdition, before he shows his other side, and reveals the true nature of his plan.
Do not be overly concerned about the Mark of the Beast, what it will be or when it will come. By the time it comes, it will already be too late. The mark of the beast is only an external indicator of a spiritual condition that already exists.

And all that dwell upon the earth shall worship him, whose names are not written in the book of life of the Lamb slain from the foundation of the world. Rev 13:8 (KJV)


Before - the false prophet appears (who is the beast with two horns like a lamb) and;
before -  he tells those that dwell on the earth to make an image to the first beast (empowered by Satan the Dragon),
before -  the image causes men to take the mark of the beast;

the people already worship the first beast, 
and the dragon that gives him its power. 
So then I ask you, is the taking of his mark something objectionable that people will be forced to do under duress? Or do the people take it willingly - even as an act of adoration and loyalty! 
I think it is the sign of the covenant between the Beast and the Dragon. The mark is given to those who already worship the beast, as these scriptures clearly indicate;

          "If any man worship the beast and his image, and receive his mark. . . " Rev. 14:9
          
          " . . . who worship the beast and his image, and whosoever receiveth the mark. . . " Rev.    14:11

" . . .which had the mark of the beast, and upon them which worshipped his image." Rev. 16:2

" . . . them that had received the mark of the beast, and them that worshipped his image. . ." Rev. 19:20
" . . . which had not worshipped the beast, neither his image, neither had received his mark . . ." Rev. 20:4

Why do they worship him and his image?

And they worshipped the dragon which gave power unto the beast: and they worshipped the beast, saying, Who is like unto the beast? who is able to make war with him? Rev 13:4 (KJV)


Because they are astonished and in awe of him! 
They say in wonderment, who is like unto the beast? Who is able to make war with him? This verse could lead you to believe that the first beast is only a government, with a superior military power; but it's more powerful than that! It is an immortal man that represents a new religion; the New World religion of Medical Science and Technology. The world government adopts this religion because it serves their purpose. The height of this religion's doctrine is the worship of immortal life, represented by the "image" of the beast. An image created by man and animated by an unholy spirit. 
Those who become like the image, will become like "gods" just as Satan promised.

Herein lies the key to understanding the Great delusion of 2 Thess 2,  the Son of Perdition is going to mimic the Christ by replicating his immortality. He is not even going to deny the existence of "God." He will most likely praise "God" for this technology. A technology that has improved our lives in so many ways. 

Who is like unto the beast? who is able to make war with him?


Who is "like" ('homoios' in the Greek) unto the beast, can also mean who is similar (in appearance or character).  Most assuredly, in a world full of mortal beings, there will be no one similar to the beast. "Who is able to make war with him," can also be translated as, who or what person can fight against him? One meaning for that translation could be, what mortal can prevail against an immortal in a fight (or war)? However, the question "Who could fight against him?" is connected to the previous statement "who is like unto the beast?" So, both phrases are used to modify the subject and object of the sentence, namely the worship of the dragon (Satan). This reveals the true sentiment behind the mindset of the people. "Who can fight against him" in the sense of who can "resist" him. Why don't they fight him? Because he is so irresistible that the people have affection for him. They love and worship him! They gladly surrender their will and comply with him. He has immortal life and (almost) everyone wants it.
No more pain or suffering. All genetic disorders and maladies - healed. 

The Pharmaceutical companies will gladly step in and become the supplier and worldwide distributors of this miracle therapy. A large segment of the world's population already accepts medications, treatments, and therapies as a part of everyday life. We have been conditioned to trust Doctors and Health Care professionals from the very beginning, starting with our childhood vaccinations. Even though some of those vaccinations are under suspicion of causing Autism and Attention Deficit Disorder. Not to worry though; the Pharmaceutical Companies have created medications for both of those disorders. 
 
How will TOTAL LIFE therapy be administered? With the advent of nanotechnology, it has now become possible to administer genetic altering therapies (and drugs) directly through the bloodstream via an injection. However, a process is in use now that enables nanoparticles to deliver therapeutics directly through a patch placed on the skin without having to get an injection.


An article that appeared in "Nature," an International weekly science journal, and posted at PhysOrg.com; outlined a successful cancer treatment procedure using nanoparticles (that targeted human DNA) called RNA interference (RNAi).
The article goes on to say that;

"These results, ......demonstrate the feasibility of using both nanoparticles and RNAi-based therapeutics in patients, and open the door for future "game-changing" therapeutics that attack cancer and other diseases at the genetic level says team leader Mark E. Davis of the California Institute of Technology. "These nanoparticles are able to take the siRNAs to the targeted site within the body," Once they reach their target, in this case, the cancer cells within tumors, the nanoparticles enter the cells and release the siRNAs. "In principle," says Dr. Davis, "that means every protein now is druggable because its inhibition is accomplished by destroying the mRNA. And we can go after mRNAs in a very designed way given all the genomic data that are and will become available."

Scientists at the University of Cambridge (Great Britain) released information regarding their latest experiments in genetics;

On Feb 15, 2010; Scientists at the University of Cambridge announced that they have created a new way of using the genetic code, by allowing proteins to be made with properties that have never been seen in the natural world. Dr. Jason Chin, who lead the effort, said the team redesigned the cell's so that it reads genetic code in quadruplets instead of the naturally occurring form which is triplets. Chin's team created 256 blank four letter forms that can be assigned to amino acids that don't even exist yet. 
A TopNews Internet article goes on to say that, "A TOTALLY new genetic code has been devised, along with machinery [meaning nano-technology] that could make it a biological reality. It's an advance that means living cells could be persuaded to make proteins with properties that have never been seen in the natural world. More extraordinary still, it could eventually lead to the creation of new or "improved" life forms that incorporate these materials in their tissue - possibly even organisms with bulletproof bodies.
New Scientist Magazine quoted Dr. Chin as saying, "It''s the beginning of a parallel genetic code." 

It doesn't take much of an imagination to see where all of this is headed. Simply perform an Internet search using the key words "Manipulation of the womb," "Genes," "Molecules," "Nanotechnology," "Bio-engineering," or "Immortality," and you'll see what exist now, and what is projected for our immediate future. 
There are technologies that exist now which are capable of replacing many of our vital organs, and limbs. Nanobots have been designed to replace our blood cells. Who knows what shape the "parallel life forms" spoken of by Dr, Chin will take. All of this, and so much more, can only point to one thing - the quest for immortal life.


There are several ways that I see the users of TOTAL LIFE therapy being "marked" in an outwardly visible manner. I've already mentioned the first one, the people openly display their affection for the Son of Perdition (the anti-Christ). They talk nice about him, revere him, and no one dare slanders his name or person in public.
Secondly, if the therapy reverses the aging process (as I suspect it will) and heals all sicknesses, than those who are older or infirm would stand out from the rest of society. In this way alone, it would be quite obvious to everyone which people reject the therapy and place their faith in Yahuah. Those who would prefer a natural death over the false promise of Satan's synthesized immortal life.

And they overcame him [the anti-Christ] by the blood of the Lamb, and by the word of their testimony; and they loved not their lives unto the death. Rev 12:11 (KJV)

"...unto the death" does not necessarily mean martyrdom alone. This verse may also be referring to a natural death.

The other method I see of being "marked" by this therapy could be a result of the therapy itself.
There is a hint of this possibility hidden in the definition of the Hebrew word "'owth," which is translated this one time, in this one place in scripture, to mean "a mark."

"Yhwh set a mark upon Cain, lest any finding him should kill him. Gen 4:15 (KJV)

In every other instance, the word "owth" is translated as a banner, token, sign, signal, or miracle. [It can also mean, beacon, monument, and omen.] 

The Hebrew word usually translated as "mark," is the word, "taw." Such as in the verse listed below:

And Yhwh said unto him [an angel], Go through the midst of the city, through the midst of Jerusalem, and set a mark [taw] upon the foreheads of the men that sigh and that cry for all the abominations that be done in the midst thereof. Ezek 9:4 (KJV)

In this verse the word "taw" [mark, #8420] means, a mark; by implication, a signature: 
to mark out, scratch or imprint. 
"Taw" always carries with it the understanding of an external or surface mark, such as a tattoo. Whereas "Owth" is prominent and more noticeable; being expressed as a signal or beacon, perhaps even something that emanates outs from within a person. 
Did Yahuah put a signal or beacon upon Cain? A beacon that manifested itself as a soft or diffused glow upon his skin, marking him as unique and separating him in appearance from the rest of mankind.
Just as Adam and Eve had a covering a light over their immortal body, perhaps Yahuah allowed a remnant of this covering to appear on Cain.
The immortal life therapy may actually replicate this "owth" that Cain bore, so that it becomes manifested on everyone who uses the therapy. 
How special indeed! To have a soft glow about oneself. 

And no wonder, for Satan himself masquerades as an angel of light. 2 Cor 11:14 (NIV)

At the heart of the "immortal life" delusion is the same old question pondered since the beginning, with a little bit of a modern twist. Does all life really originate from Yahuah? Does He sustain all living things? Or was He just the first one to discover the knowledge of self existence and learn to control it ? Do we think that since we have unraveled the mysteries of life and discovered its hidden secrets, that we are now equal with the Creator? Can we create our own "back door" into perfect health and immortal life?
In John 10:9; Yahuahshua tells everyone that He is "the door." The door to the sheepfold (or courtyard) where the sheep wait, who are to be lead out by the shepherd to eternal life. The interesting thing about this parable is that Yahuahshua says there is another way into the sheepfold, a "back door."

Verily, verily, I say unto you, He that entereth not by the door into the sheepfold, but climbeth up some other way, the same is a thief and a robber. John 10:1 (KJV)

The one who tries to climb up "some other way" is the thief. He is Satan. The "other way" is his "immortal" life therapy. If this were not possible, Yahuahshua would not have told us about "some other way."

The Book of Daniel gives us an additional insight into how Satan will take that which belongs to only to Yahuah and Yahuahshua - self existent life!

And from one of them came a little horn which became exceedingly great toward the south, and toward the east, and toward the Splendid Land.

There is a dual nature to this prophecy. The little horn is historically accepted to be the Greek General Antiochus Epiphanies who conquered Judea and defiled the Holy of Holies in Solomon's temple. The next verse, because of its context, is where the historical reference to Antiochus Epiphanies becomes an allegory for a future prophecy about the Satan, and how he is going to reach out and take that "which is continual,"

And it became great, up to the host of the heavens. And it caused some of the host and some of the stars to fall to the earth and trampled them down.
It even exulted itself as high as the prince of the host, and it took that which is continual away from him, and threw down the foundation of his set apart place.

Who is the the "Prince of the Host?" Joshua chapter 5 answers this question. It is Yahuahshua the Messiah;


And it came to pass, when Joshua was by Jericho, that he lifted up his eyes and looked, and, behold, there stood a man over against him with his sword drawn in his hand: and Joshua went unto him, and said unto him, Art thou for us, or for our adversaries?
And he said, Nay; but as captain of the host of YAHUAH am I now come. And Joshua fell on his face to the earth, and did worship, and said unto him, What saith my Adone (Master) unto his servant?
And the captain of YAHUAH'S host said unto Joshua, Loose thy shoe from off thy foot; for the place whereon thou standest is holy. And Joshua did so. Josh 5:13-15 (KJV)


The first thing to notice is the Hebrew word for "captain" [#8269] is "sar." It is the exact same word translated above as "Prince." The prince of the host in DaniUl's vision is the Captain of the host of YAHUAH that appeared to Joshua. How can we know for sure. Joshua fell to the ground and worshipped him. The Captain of the host of Yahuah accepted Joshua's worship and had him remove his shoes because he stood on holy ground. The Captain of the Host of Yahuah is Yahuahshua Ha Mashiyach, the "Sar Shalom," or Prince of Peace.

In light of this revelation, who is it, in DaniUl 8:11 that exults himself as high as Yahuahshua, the Captain of the Hosts of Yahuah? It is none other than Satan. He is there to take away that which is continual and bestow it on his son, the Son of Perdition. It will be granted by Yahuah, in order to send the people the strong delusion of 2 Thessalonians 2.
Satan will use that which is "continual" to enable himself and others to live in a sinful immortal body of flesh! This is the exact thing that Yahuah condemned in the Garden of Eden by not allowing Adam to reach out and eat from the Tree of Life, to live forever while he was in a sinful state.
This is how Satan will "throw down" the foundation of Yahuah's temple. He will defile the "temple," that is the body of man which is made in Yahuah's image. 


DaniUl chapter 8 verses 9, 10, & 11, as it appears in the "The Scriptures" translated from the original Hebrew by "The Institute For Scripture Research." 


Every believer must come to a place in their faith where they are not afraid to die. I'm not referring exclusively to martyrdom, but also the temptation to avoid even a natural death, when the option becomes available. Those who are deceived into taking the immortal life therapy will eventually suffer death anyway, when they are finally allowed to die.  Who else can these people be, which are spoken of in the verses listed below; except those who have taken the immortal life therapy and cannot even commit suicide during the time of their torment:

And to them (the locusts) it was given that they should not kill them (those who have not the seal of Yhwh), but that they should be tormented five months: and their torment was as the torment of a scorpion, when he striketh a man.
And in those days shall men seek death, and shall not find it; and shall desire to die, and death shall flee from them. Rev 9:5-6 (KJV)


How could people actually seek death, even attempt suicide, yet not die! Most likely they have altered their genome to that of the Beast's image.  Once someone starts down the road to synthetic immortal life, there is no turning back.
At the end of it all, once the beast's kingdom is brought to obscurity and plunged into darkness, those who bear the mark of the beast (contain his genome) will no longer be able to obtain the therapy. That's when the horror of their withdrawal begins, A withdrawal with no end.

And the fifth angel poured out his vial upon the seat [center of power ]of the beast; and his kingdom was full of darkness; and they gnawed their tongues for pain, And blasphemed the Mighty One
of heaven because of their pains and their sores, and repented not of their deeds. Rev 16:10-11 (KJV)

But there is still more to come! At this point in the "Last Days," consider the desperate and final acts of an insane and totally out of control world. World leaders have completely corrupted the biological integrity of Yahuah's creation, from genetically modified foods, to genetically modified humans. Now, as a final act of depravity, they gather together to make war against the returning Messiah of Yahuah. They actually believe they can win by destroying Him and the army of heaven in a single huge battle!


And I saw the beast, the kings of the earth, and their armies, gathered together to make war against Him [Christ] who sat on the horse and against His army [the host of heaven]. (verse 19)

THEY, are gathered to make war!
What could make the armies of the earth so bold as to gather together to make war against Yahuahshua and the Army of Heaven?
It is because all of those gathered to fight against Him are not mere mortal men, they are a combination of enhanced or trans-human beings; biologically engineered creatures that are immortal,  perhaps even part mechanical or cyborg. In short, they are 21st Century Gibborim (mighty men). Who else would even attempt to oppose an Army of Heaven made up of eternal creatures? The stated purpose of their gathering is to make war against the rider of the white horse (Yahuahshua) and his Army. I consider this strategy to be the logical conclusion of Satan's original plan to eradicate mankind and create a race of immortal beings who can make war against heaven itself. Immortals that could ascend the mountain of Yahuah and rule in His place. This is not a re-write of the classic, Clash of the Titans. The battle is real and it's coming! 
When Adam handed over his authority to Satan, it was a legal transfer of power. Satan didn't take Adam's authority by force, it was given to him. Ask yourself this question, if Satan's counterfeit reality was a sham, or in any way lacking real power; why didn't Yahuah just wait for it to wind down, fade away, or just implode. 
The answer must be, it is a "stand alone" reality that would continue to exist without interruption, forever.  This is why it took the direct intervention of Yahuah himself. This has always been about total war! Do you think Yahuah's strategy to overthrow Satan's kingdom was without risk? I realize that according to the scriptures, Satan's defeat is already a foregone conclusion; and I wholeheartedly agree- by faith. Even so, his plan to redeem creation would have to be worked out in real time, under the legal conditions of the fall, so the power and authority lost by the first Adam could be regained by the second Adam (Yahuahshua). If there weren't any risks involved, was the threat real? If the threat imposed by the counterfeit reality wasn't real, was Yahuahshua's death necessary? 
I believe it was all very real! More real than we can fathom this side of heaven. 

The original strategy used by Satan and the fallen angels to corrupt the genome, is being implemented at this very moment through genetic engineering. The time is quickly approaching, when the Holy Spirit will cease to restrain Satan at all (2 Thessalonians 2:7). 
One need only to look at the world around us. Politically, we are seeing the formation of a single world wide government. Freedoms and liberties are being reduced or in many cases completely  taken away. As a society, we in the United States move closer each year to a form of National Socialism (or Statism). Economically, our prosperity has declined rapidly. There is a worldwide economic downturn. Many of the top industrialized nations (including the US) have acquired trillions of dollars of debt. Added to this debt annually is trillions of dollars of deficit spending, all of which is accruing interest.  At a time when the people should be demanding an accounting from government; governments are installing more and more surveillance cameras to record everyone's movements.
We are being boxed in and made ready for the great "moment of decision." There will be no place to run. Who will you choose, Barabbas, or Yahuahshua; Satan's lie or Yahuah's truth?

The coming race of Gibborim, can be seen in Joel's end times prophecy of chapter 2 (shown below):

Blow the trumpet in Zion, and sound an alarm in My holy mountain! Let all the inhabitants of the land tremble; for the day of YAHUAH is coming, for it is at hand: A day of darkness and gloominess, a day of clouds and thick darkness, like the morning clouds spread over the mountains. A people come, great and strong (Gibborim), the like of whom has never been (a new man made creature never seen before); nor will there ever be any such after them, even for many successive generations (they will be destroyed).
A fire devours before them, and behind them a flame burns; the land is like the Garden of Eden before them
(a reference back to Eden, where genetic engineering first began), and behind them a desolate wilderness; (Satan destroying Yahuah's creation) surely nothing shall escape them. Their appearance is like the appearance of horses; and like swift steeds, so they run.
With a noise like chariots over mountaintops they leap, like the noise of a flaming fire that devours the stubble, like a strong people set in battle array.
Joel 2:1-32

Compare these last two verses in Joel to Rev 9:7-9 (below); 

And the shapes of the locusts were like unto horses prepared unto battle; ....and the sound of their wings was as the sound of chariots of many horses running to battle. (KJV)] Rev 9:7-9 (excerpts)

Before them the people writhe in pain; all faces are drained of color .....Joel (YawUl) 2:6

This condition could be caused simply by shock! Perhaps these creatures were hidden from view and this is the first time they are being seen by humanity. Or, these creatures could be using a microwave cannon that literally cooks any person who stands in the path of its radiation, causing them to writhe in pain.

They run like mighty men
(gibborim), they climb the wall like men of war; every one marches in formation, and they do not break ranks. Neither shall one thrust (or push one) another; they shall walk (march) every one in his path (column).

They sound mechanical in nature.


and when they fall upon the sword, they shall not be wounded
(or stop). Joel 2:8 (KJV) and (NKJ).

They are immortal. The sword cannot wound them.

They run to and fro
(they seek like a beast of prey) in the city, they run on the wall; they climb into the houses, they enter at the windows like a thief.
The earth quakes before them, the heavens tremble; the sun and moon grow dark, and the stars diminish their brightness. 


This is a horrible creature, of an uncertain type. They are able to make the earth quake and the heavens tremble;


YAHUAH gives voice before His army, .......

This is His army of Rev 19:19, the army of Yahuahshua and the hosts of heaven.

.....for His camp is very great; for strong is the One who executes His word. For the day of YAHUAH is great and very terrible; who can endure it?

This is an extraordinary and cataclysmic event  The threat posed by these creatures, and their leaders; compels none other than the Creator Himself to answer this attack.


How much longer will it be before we see the fulfillment of DaniUl's prophecy of Chapter 2;

And whereas thou sawest iron mixed with miry clay, they shall mingle themselves with the seed of men: but they shall not cleave one to another, even as iron is not mixed with clay.
And in the days of these kings shall Yhwh Ul of heaven set up a kingdom, which shall never be destroyed: and the kingdom shall not be left to other people, but it shall break in pieces and consume all these kingdoms, and it shall stand for ever. Dan 2:43-44 (KJV)

Yahuah Ul sets up His kingdom right after the tribulation, or "Day of Yahuah."

The significance behind this prophecy is quite clear. Iron is classified as an element and is therefore not a man made metal. Whereas, clay is man made. At the wedding ceremony at Cana, when the water was changed into wine, the clay pots were used as a simile for our bodies of flesh, which are made of earth (clay). 
The clay has the same meaning in DaniUl's prophecy. The iron, in its pure form, has been made by Yahuah, and not by the hand of man. It is symbolic of the angelic beings (made also by the hand of Yahuah) which left their proper domain to commingle with the daughters of men. They are no longer pictured as being covered in gold, like the angels that stood guard over the ark of the testimony in Solomon's temple. They are now represented by iron, a strong yet less precious form of metal. They are the Nephilim who created the giants know as the Ghibborim.

The English  translation "...they shall mingle themselves with the seed of man.." 
comes from the Hebrew word; "`arab" [#6151] meaning to commingle; 
which is from the root word "`arab" [#6148] meaning to braid, and intermix. 

A "braid" made from three parts of something (like hair or rope) and twisted together. 
This is a picture of DNA. 
The proper name derived from the noun, "arab" illustrates the intermixing of Abraham's seed with Hagar, which produced the first Arab person by the name of Ishmael.

DaniUl's prophecy is about the end times genetic engineering which will produce hybrid creatures that are both human and angelic. They will possess immortal life. It is during this time that Mashiyach will return and restore order to Yahuah's creation.
He will remove everything that offends, smashing it into pieces.

"...a stone was cut out without hands, which struck the image on its feet of iron and clay, and broke them in pieces. Dan 2:34 (NKJ)


Who exactly is the Son of Perdition? What nationality or ethnicity will he be? What Political powers will he have? Will he be an internationally known religious figure?

As the tribulation gets closer, the Son of Perdition gradually begins to come into view. The scriptures point out that the credibility he receives as the Messiah, is based on how well he mimics the works of Yahuahshua. It won't be with words and a future promise of glory.

After all, isn't that what the last guy promised almost 2000 years ago? 

"...knowing this first: that scoffers will come in the last days, walking according to their own lusts, and saying, Where is the promise of his coming? for since the fathers fell asleep, all things continue as they were from the beginning of the creation." 2 Pet 3:3-4 (KJV)

This Messiah, the Son of Perdition, is coming with immortal life for the here and now.

As I wrote in the beginning of this book, the scriptures are a story about "the body;" and in a deeper sense, genetics. That may seem like an over simplification of something that must be more complicated, but it is not. Adam had a certain type of body that enabled him to live in the presence of Yahuah. Through an act of sin, Adam's body changed, which subsequently caused him to be separated from the bodily presence of his Creator.
The main point being, not only did sin impact Adam's spiritual relationship with Yahuah, but it also changed his physiology. His body took on the nature of sin and eventually died. And even though a person could repent from sin and restore their spiritual relationship with Yahuah, no mortal man could redeem his own body. For this reason Yahuah sent His Messiah, to reverse the bondage of death. If Adam had delighted in Yahuah's will, and reached out to eat of the tree of life, he would have ate the DNA of eternal life; and changed an immortal body into an eternal self existent life.

"He who has an ear, let him hear what the Spirit says to the churches. To him who overcomes I will give (the right) to eat from the tree of life, which is in the midst of the Paradise of Yahuah."' Rev 2:7 (NKJ)

Think about the Olive tree branch, with its feather shaped leaves that grow opposite one another, and are similar in appearance to the base pairs of DNA.
Compare this image to the tree of life, as it appears in the Book of Revelation, at the end of time;

"...the tree of life, which bare twelve manner of fruits, and yielded her fruit every month: and the leaves of the tree were for the healing of the nations (or people)." Rev 22:2 (KJV)

The leaves (DNA) are for the healing of the people. What was their sickness?" Mortality. 
Also notice that in the restored Garden of Eden, seen in the Book of Revelation, there is fruit on the tree of life. Fruit that was not present on the tree of life described in Genesis Chapter One. Adam and his wife did not produce fruit (a lineage) upon that tree. It wasn't until the completed work of Messiah that the tree of life could bear, "twelve manner of fruits." Adam and Eve were supposed to eat of the tree of life, gain eternal life; and produce children (fruit) that were descendant from Yahuah. Instead, they caused a breech in his lineage. It took the work of Yahuahshua to heal that breech. 

A picture of the breech can be seen in the divided house of Israel, when the House of Joseph broke off from the House of Judah. 
There is somewhat of an interesting play on words evident in Ezekiel's prophecy about the two sticks (or Houses) being joined back together.


The word translated as
"tree," in "the tree of life" (Genesis 2:16) is "`ets" [#6086]; meaning, a tree. But it can also be translated (in the plural) as "sticks," as in Ezekiel 37:16-19.

Moreover, thou son of man, take thee one stick, and write upon it, For Judah, and for the children of Israel his companions: then take another stick, and write upon it, For Joseph, the stick of Ephraim, and for all the house of Israel his companions:
And join them one to another into one stick; and they shall become one in thine hand.
And when the children of thy people shall speak unto thee, saying, Wilt thou not shew us what thou meanest by these?
Say unto them, Thus saith Yahuah; Behold, I will take the stick of Joseph, which is in the hand of Ephraim, and the tribes of Israel his fellows, and will put them with him, even with the stick of Judah, and make them one stick, and they shall be one in mine hand. Ezek 37:16-19 (KJV)


After Solomon's reign; the Nation of Israel (all 12 tribes) was divided into two Nations (or Houses). The northern 10 tribes (or the House of Israel) became the Northern Kingdom. (They were also called the House of Joseph or Ephraim). The Southern Kingdom, which was comprised of the tribes of Judah, Benjamin, and Levi was known as the House of Judah. Ezekiel prophesied that one day, the two Houses would be joined together again, as a single nation, as they were under King David.
Ezekiel is instructed by Yahuah to write a message on two separate sticks, which will then be joined together in his hand.
Ezekiel's stick is usually represented (by facsimile) as a walking staff made by two separate sticks of the same length, coiled together in the shape of a double helix.
This is the symbolic message behind Ezekiel's prophecy. The Messiah would not come from the line of Judah alone, but also through the line of Joseph. 

Through His body and by His DNA, He cancelled out the Law of sin and death, and inherited eternal life.
Through His body and by His DNA, He re-united both Houses of Israel, thus fulfilling Joseph's dream.

From Genesis to Revelation, DNA is the common denominator in everything made by Yahuah.  It is the "fence" designed to keep some things in and other things out. It is the power to preserve the integrity and design of all life forms. 

It is the Creator's building block.

Its perfection is represented in the eternal body of the resurrected Messiah.

Its perfect corruption will be seen in the desolate form of the Son of Perdition.

Pray often, to know what Yahuah's will is for your life at this point in time. Because at this very moment, Yahuahshua stands at the door and knocks.

But soon, a beautiful delusion will stand at the door and also knock.

[Yahuahshua said to the disciples] "As for you, then, be on guard against the world. Prepare yourself with great strength, so the robbers can't find a way to get to you, for the trouble you expect will come. Gospel of Thomas, saying #22.


credits 

* http://www.biotech.iastate.edu/biotech_info_series/bio1.html



Changing stem celles into sperm and eggs. Article origianlly published in the journal Nature.
http://med.stanford.edu/ism/2009/october/germ-cells.html [stem cells into sperm]
http://www.reuters.com/article/idUSTRE59R4V520091028 [stem cell research]



Map of Old Jerusalem
University of Texas at Austin. Historical Atlas by William Shepherd (1923-26)



http://www.web-books.com/MoBio/Free/Ch1B5.htm (Blood antigens)



http://www.heaven.net.nz/writings/thebookofenoch.htm



http://www.lef.org/magazine/mag2010/jun2010_Immortal-Stem-Cells-for-Anti-Aging-Therapies_01.htm
(Michael West)



Picture of High Priest's garments

http://www.biblepicturegallery.com/free/screen-sized%20pictures.htm
200 free pictures from thousands at the Bible Picture Gallery








Home Short Study
 Lessons
- Index
Short Study 
Notes
- Index
Articles &
Essays Index
Library Links

Post your comments at our Forum